Incidental Mutation 'R1131:Fnip1'
ID94635
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Namefolliculin interacting protein 1
SynonymsA730024A03Rik
MMRRC Submission 039204-MU
Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene? Possibly essential (E-score: 0.729) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54438199-54518235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54493303 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 342 (E342V)
Ref Sequence ENSEMBL: ENSMUSP00000049026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046835
AA Change: E342V

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: E342V

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143650
AA Change: E318V

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992
AA Change: E318V

DomainStartEndE-ValueType
Pfam:FNIP_N 17 139 3.9e-36 PFAM
Pfam:FNIP_M 288 526 5.1e-87 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
Normandy UTSW 11 54493181 splice site probably benign
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
R7009:Fnip1 UTSW 11 54502935 missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54466125 missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54515499 missense probably benign 0.41
R7866:Fnip1 UTSW 11 54465402 start gained probably benign
R7939:Fnip1 UTSW 11 54502267 missense probably damaging 1.00
R7943:Fnip1 UTSW 11 54502388 missense probably damaging 1.00
R8429:Fnip1 UTSW 11 54475696 missense possibly damaging 0.94
R8546:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R8753:Fnip1 UTSW 11 54510041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTTCATGACTCAGGCTGGGCAG -3'
(R):5'- GCAGCTCCTGGAGCAGATTGTAAAG -3'

Sequencing Primer
(F):5'- GGTTCAGAAACTTCATGTTTCCG -3'
(R):5'- TGTAAAGTAAGTTCAAGACACCTACC -3'
Posted On2014-01-05