Incidental Mutation 'R1023:Gnpat'
ID 94636
Institutional Source Beutler Lab
Gene Symbol Gnpat
Ensembl Gene ENSMUSG00000031985
Gene Name glyceronephosphate O-acyltransferase
Synonyms D1Ertd819e
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock # R1023 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 124863033-124890057 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 124870780 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 27 (D27V)
Ref Sequence ENSEMBL: ENSMUSP00000034466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034466] [ENSMUST00000161986]
AlphaFold P98192
Predicted Effect probably benign
Transcript: ENSMUST00000034466
AA Change: D27V

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034466
Gene: ENSMUSG00000031985
AA Change: D27V

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
SCOP:d1dbha1 27 146 6e-3 SMART
PlsC 155 284 8.3e-21 SMART
Blast:PlsC 308 336 1e-6 BLAST
low complexity region 638 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161986
AA Change: D27V

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125323
Gene: ENSMUSG00000031985
AA Change: D27V

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
PlsC 145 274 8.3e-21 SMART
Blast:PlsC 298 326 2e-6 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme located in the peroxisomal membrane which is essential to the synthesis of ether phospholipids. Mutations in this gene are associated with rhizomelic chondrodysplasia punctata. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice lack plasmalogens due to inactivation of ether lipid synthesis. Mutant mice exhibit dwarfism, male infertility, defects in eye development, and optic nerve hypoplasia. While some mice die prematurely, others, particularly females, are long-lived. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Gnpat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Gnpat APN 8 124876914 splice site probably benign
IGL00422:Gnpat APN 8 124885013 missense probably damaging 1.00
IGL01327:Gnpat APN 8 124878633 missense probably damaging 1.00
IGL02257:Gnpat APN 8 124886848 unclassified probably benign
IGL02951:Gnpat APN 8 124870905 missense probably benign 0.01
IGL03084:Gnpat APN 8 124878899 missense probably damaging 0.99
R0114:Gnpat UTSW 8 124883357 missense probably benign 0.06
R0394:Gnpat UTSW 8 124880225 missense possibly damaging 0.82
R1052:Gnpat UTSW 8 124877507 missense probably benign 0.00
R1052:Gnpat UTSW 8 124878516 missense probably damaging 1.00
R1537:Gnpat UTSW 8 124870816 missense probably damaging 0.97
R1604:Gnpat UTSW 8 124876961 missense probably damaging 1.00
R1711:Gnpat UTSW 8 124886952 splice site probably null
R1754:Gnpat UTSW 8 124877006 missense probably damaging 1.00
R2118:Gnpat UTSW 8 124876941 missense probably damaging 0.99
R2278:Gnpat UTSW 8 124876920 missense probably benign 0.35
R2429:Gnpat UTSW 8 124877019 missense probably damaging 1.00
R4579:Gnpat UTSW 8 124878502 splice site probably null
R6176:Gnpat UTSW 8 124878854 missense probably damaging 1.00
R7017:Gnpat UTSW 8 124863275 missense probably benign 0.33
R7081:Gnpat UTSW 8 124863269 missense possibly damaging 0.53
R7388:Gnpat UTSW 8 124887814 missense probably benign 0.32
R7716:Gnpat UTSW 8 124876934 missense probably benign 0.32
R7848:Gnpat UTSW 8 124886891 missense possibly damaging 0.89
R8169:Gnpat UTSW 8 124880130 missense probably benign 0.02
R8355:Gnpat UTSW 8 124870840 missense probably benign 0.11
R8363:Gnpat UTSW 8 124863299 missense probably benign 0.28
R8851:Gnpat UTSW 8 124874265 missense probably damaging 1.00
R9234:Gnpat UTSW 8 124883440 missense probably damaging 1.00
R9276:Gnpat UTSW 8 124887785 missense probably benign 0.45
R9701:Gnpat UTSW 8 124886939 missense probably benign 0.01
X0025:Gnpat UTSW 8 124873399 missense probably null 0.99
Z1177:Gnpat UTSW 8 124863296 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCAGACAAAATGAGTTTGTAGATGTGG -3'
(R):5'- ACAACTCTGCTCTTACCTGCTTAATGAC -3'

Sequencing Primer
(F):5'- tccaacaaaacaaaaccaccag -3'
(R):5'- CCTGCTTAATGACATAGTTGATCTC -3'
Posted On 2014-01-05