Incidental Mutation 'R1131:Ggt6'
ID94639
Institutional Source Beutler Lab
Gene Symbol Ggt6
Ensembl Gene ENSMUSG00000040471
Gene Namegamma-glutamyltransferase 6
Synonyms
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1131 (G1)
Quality Score203
Status Not validated
Chromosome11
Chromosomal Location72435526-72438400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72435680 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 21 (E21G)
Ref Sequence ENSEMBL: ENSMUSP00000104139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076443] [ENSMUST00000100903] [ENSMUST00000108499]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076443
AA Change: E21G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075773
Gene: ENSMUSG00000040471
AA Change: E21G

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 124 179 1.4e-9 PFAM
Pfam:G_glu_transpept 180 276 7.6e-11 PFAM
Pfam:G_glu_transpept 327 402 1.4e-9 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 475 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100903
AA Change: E21G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098463
Gene: ENSMUSG00000040471
AA Change: E21G

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 125 238 2.1e-11 PFAM
Pfam:G_glu_transpept 290 367 6.7e-9 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108499
AA Change: E21G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104139
Gene: ENSMUSG00000040471
AA Change: E21G

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Ggt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Ggt6 APN 11 72436806 missense possibly damaging 0.51
hallo UTSW 11 72437667 missense probably damaging 0.98
IGL03097:Ggt6 UTSW 11 72436813 missense possibly damaging 0.71
R0080:Ggt6 UTSW 11 72437195 missense possibly damaging 0.92
R0178:Ggt6 UTSW 11 72436818 missense possibly damaging 0.71
R0595:Ggt6 UTSW 11 72437667 missense probably damaging 0.98
R0842:Ggt6 UTSW 11 72437262 nonsense probably null
R1606:Ggt6 UTSW 11 72437733 missense possibly damaging 0.92
R2029:Ggt6 UTSW 11 72437541 missense possibly damaging 0.90
R2359:Ggt6 UTSW 11 72437551 missense possibly damaging 0.92
R2869:Ggt6 UTSW 11 72437361 missense probably benign 0.00
R2869:Ggt6 UTSW 11 72437361 missense probably benign 0.00
R4462:Ggt6 UTSW 11 72437828 missense possibly damaging 0.52
R4608:Ggt6 UTSW 11 72437943 missense probably benign 0.04
R4735:Ggt6 UTSW 11 72436599 missense probably benign
R5431:Ggt6 UTSW 11 72437738 missense possibly damaging 0.71
R5648:Ggt6 UTSW 11 72435716 missense possibly damaging 0.46
R6390:Ggt6 UTSW 11 72436611 missense possibly damaging 0.86
R6717:Ggt6 UTSW 11 72437520 nonsense probably null
R7506:Ggt6 UTSW 11 72437898 missense possibly damaging 0.73
R7798:Ggt6 UTSW 11 72435541 start gained probably benign
Z1177:Ggt6 UTSW 11 72436599 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAAGAGCCCCGAGTCCTAACGAG -3'
(R):5'- AAGTGTGAGATTGCCTGACCCAGC -3'

Sequencing Primer
(F):5'- CCTAACGAGGCAGGCTCATAG -3'
(R):5'- AGCTTAGGGATTCCAGAGAGAG -3'
Posted On2014-01-05