Incidental Mutation 'R1023:Gm10608'
ID 94640
Institutional Source Beutler Lab
Gene Symbol Gm10608
Ensembl Gene ENSMUSG00000074029
Gene Name predicted gene 10608
Synonyms EG546165
MMRRC Submission 039125-MU
Accession Numbers

Genbank: XR_031269; Ensembl: ENSMUST00000093527; MGI: 3642009

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R1023 (G1)
Quality Score 150
Status Validated
Chromosome 9
Chromosomal Location 119162652-119164087 bp(+) (GRCm38)
Type of Mutation small deletion (2 aa in frame mutation)
DNA Base Change (assembly) CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA at 119160716 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010795] [ENSMUST00000093527]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000010795
SMART Domains Protein: ENSMUSP00000010795
Gene: ENSMUSG00000010651

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 6.7e-90 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093527
SMART Domains Protein: ENSMUSP00000091246
Gene: ENSMUSG00000074029

DomainStartEndE-ValueType
Pfam:DUF3915 11 80 3.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213924
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Gm10608
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Gm10608 UTSW 9 119161088 unclassified probably benign
R1053:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1167:Gm10608 UTSW 9 119160716 frame shift probably null
R1172:Gm10608 UTSW 9 119160716 frame shift probably null
R1211:Gm10608 UTSW 9 119160712 frame shift probably null
R1601:Gm10608 UTSW 9 119160716 frame shift probably null
R1743:Gm10608 UTSW 9 119160716 small deletion probably benign
R1766:Gm10608 UTSW 9 119160716 frame shift probably null
R1939:Gm10608 UTSW 9 119160716 frame shift probably null
R2016:Gm10608 UTSW 9 119160716 small deletion probably benign
R2127:Gm10608 UTSW 9 119160716 small deletion probably benign
R2217:Gm10608 UTSW 9 119160716 frame shift probably null
R2270:Gm10608 UTSW 9 119160716 frame shift probably null
R2372:Gm10608 UTSW 9 119160716 small deletion probably benign
R2844:Gm10608 UTSW 9 119160716 frame shift probably null
R2959:Gm10608 UTSW 9 119160716 frame shift probably null
R2968:Gm10608 UTSW 9 119160716 small deletion probably benign
R3084:Gm10608 UTSW 9 119160716 frame shift probably null
R3607:Gm10608 UTSW 9 119160716 small deletion probably benign
R3702:Gm10608 UTSW 9 119160716 frame shift probably null
R3779:Gm10608 UTSW 9 119160716 small deletion probably benign
R3839:Gm10608 UTSW 9 119160716 frame shift probably null
R3900:Gm10608 UTSW 9 119160716 frame shift probably null
R3947:Gm10608 UTSW 9 119160662 small deletion probably benign
R4015:Gm10608 UTSW 9 119160716 frame shift probably null
R4024:Gm10608 UTSW 9 119160716 small deletion probably benign
R5346:Gm10608 UTSW 9 119160724 frame shift probably null
R8225:Gm10608 UTSW 9 119160708 frame shift probably null
X0065:Gm10608 UTSW 9 119160863 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCATAATGTGACAGGTGCCACAAC -3'
(R):5'- CACAGAAAAGATGCCATTGCCTGC -3'

Sequencing Primer
(F):5'- GTGCCACAACAGGGCAG -3'
(R):5'- TCAGATGGCAAAGCTTCCTG -3'
Posted On 2014-01-05