Incidental Mutation 'R1131:Hnrnpk'
ID94648
Institutional Source Beutler Lab
Gene Symbol Hnrnpk
Ensembl Gene ENSMUSG00000021546
Gene Nameheterogeneous nuclear ribonucleoprotein K
SynonymshnRNPK, KBBP, Hnrpk
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location58391142-58403343 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 58394165 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043269] [ENSMUST00000116403] [ENSMUST00000175847] [ENSMUST00000176207] [ENSMUST00000176305] [ENSMUST00000176558] [ENSMUST00000176849] [ENSMUST00000177019] [ENSMUST00000177060] [ENSMUST00000177117] [ENSMUST00000177497] [ENSMUST00000224030] [ENSMUST00000224182] [ENSMUST00000224342] [ENSMUST00000224524] [ENSMUST00000224836] [ENSMUST00000225031] [ENSMUST00000225176] [ENSMUST00000225674]
Predicted Effect probably null
Transcript: ENSMUST00000043269
SMART Domains Protein: ENSMUSP00000039269
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 143 214 2.66e-12 SMART
low complexity region 252 279 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
KH 386 456 3.12e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083500
Predicted Effect probably null
Transcript: ENSMUST00000116403
SMART Domains Protein: ENSMUSP00000112104
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 143 214 2.66e-12 SMART
low complexity region 252 279 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
KH 386 456 3.12e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175847
SMART Domains Protein: ENSMUSP00000134837
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
Pfam:ROKNT 1 43 7.6e-24 PFAM
Pfam:KH_4 21 70 1.4e-9 PFAM
Pfam:KH_2 25 74 4.4e-7 PFAM
Pfam:KH_1 44 72 3.5e-8 PFAM
Pfam:KH_3 54 73 9.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175939
Predicted Effect probably null
Transcript: ENSMUST00000176207
SMART Domains Protein: ENSMUSP00000135354
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 119 190 2.66e-12 SMART
low complexity region 228 255 N/A INTRINSIC
low complexity region 261 277 N/A INTRINSIC
low complexity region 283 291 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 341 357 N/A INTRINSIC
KH 362 432 3.12e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176269
Predicted Effect probably benign
Transcript: ENSMUST00000176305
SMART Domains Protein: ENSMUSP00000135305
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 143 214 2.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176359
Predicted Effect probably benign
Transcript: ENSMUST00000176558
SMART Domains Protein: ENSMUSP00000135623
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 96 6.49e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176725
Predicted Effect probably null
Transcript: ENSMUST00000176797
Predicted Effect probably benign
Transcript: ENSMUST00000176849
SMART Domains Protein: ENSMUSP00000135342
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 119 190 2.66e-12 SMART
low complexity region 228 255 N/A INTRINSIC
low complexity region 261 277 N/A INTRINSIC
low complexity region 283 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176888
Predicted Effect probably null
Transcript: ENSMUST00000177019
SMART Domains Protein: ENSMUSP00000135647
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 119 190 2.66e-12 SMART
low complexity region 228 255 N/A INTRINSIC
low complexity region 261 277 N/A INTRINSIC
low complexity region 283 291 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 341 357 N/A INTRINSIC
KH 362 432 3.12e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177051
Predicted Effect probably benign
Transcript: ENSMUST00000177060
SMART Domains Protein: ENSMUSP00000135407
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
KH 38 106 4.56e-11 SMART
KH 116 177 2.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177117
SMART Domains Protein: ENSMUSP00000135109
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
Blast:KH 3 40 2e-18 BLAST
Pfam:KH_1 53 87 2.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177377
Predicted Effect probably null
Transcript: ENSMUST00000177497
SMART Domains Protein: ENSMUSP00000135833
Gene: ENSMUSG00000021546

DomainStartEndE-ValueType
Blast:KH 3 40 8e-16 BLAST
KH 74 145 2.66e-12 SMART
low complexity region 183 210 N/A INTRINSIC
low complexity region 216 232 N/A INTRINSIC
low complexity region 238 246 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
KH 317 387 3.12e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224030
Predicted Effect probably null
Transcript: ENSMUST00000224182
Predicted Effect probably benign
Transcript: ENSMUST00000224342
Predicted Effect probably benign
Transcript: ENSMUST00000224524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224782
Predicted Effect probably benign
Transcript: ENSMUST00000224836
Predicted Effect probably benign
Transcript: ENSMUST00000225031
Predicted Effect probably benign
Transcript: ENSMUST00000225176
Predicted Effect probably null
Transcript: ENSMUST00000225674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226015
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex, and is a poly-cytosine binding protein (PCBP). It is found in multiple subcellular compartments including the nucleus, cytoplasm and mitochondria. This gene product is thought to interact with RNA, DNA, and protein, and is involved in multiple cellular processes, including transcription, chromatin remodeling, DNA damage response, signal transduction, mRNA splicing, export, and translation. Multiple transcript variants and protein isoforms exist, with some isoforms containing a unique C-terminus. There are four pseudogenes of this gene, found on chromosomes 2, 3, 7 and 13. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Hnrnpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Hnrnpk APN 13 58395297 splice site probably benign
IGL03181:Hnrnpk APN 13 58394316 missense possibly damaging 0.67
R0136:Hnrnpk UTSW 13 58395177 missense probably benign 0.01
R1690:Hnrnpk UTSW 13 58400354 missense probably benign 0.23
R1956:Hnrnpk UTSW 13 58396186 critical splice donor site probably null
R4525:Hnrnpk UTSW 13 58393882 splice site probably benign
R4663:Hnrnpk UTSW 13 58394517 missense probably damaging 0.98
R4754:Hnrnpk UTSW 13 58399136 unclassified probably benign
R5473:Hnrnpk UTSW 13 58394099 missense probably damaging 0.99
R5830:Hnrnpk UTSW 13 58397734 nonsense probably null
R5937:Hnrnpk UTSW 13 58395202 missense probably damaging 1.00
R5997:Hnrnpk UTSW 13 58399157 missense probably damaging 1.00
R6188:Hnrnpk UTSW 13 58394153 missense probably benign 0.11
R6461:Hnrnpk UTSW 13 58393194 critical splice donor site probably null
R7505:Hnrnpk UTSW 13 58399969 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCCGCCAAGATCACCATATGAG -3'
(R):5'- GAGACCGCTATGATGGCATGGTAAG -3'

Sequencing Primer
(F):5'- GCCCCCTGCATAAGAATAGTCTG -3'
(R):5'- AGAATTTTGATTTATAAGGGCGGC -3'
Posted On2014-01-05