Incidental Mutation 'R1023:Pold2'
ID 94649
Institutional Source Beutler Lab
Gene Symbol Pold2
Ensembl Gene ENSMUSG00000020471
Gene Name polymerase (DNA directed), delta 2, regulatory subunit
Synonyms p50, 50kDa, po1D2
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1023 (G1)
Quality Score 128
Status Validated
Chromosome 11
Chromosomal Location 5872180-5878292 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 5875140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 86 (Q86K)
Ref Sequence ENSEMBL: ENSMUSP00000099986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102922] [ENSMUST00000102923] [ENSMUST00000109829] [ENSMUST00000153995]
AlphaFold O35654
Predicted Effect probably benign
Transcript: ENSMUST00000102922
AA Change: Q86K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099986
Gene: ENSMUSG00000020471
AA Change: Q86K

DomainStartEndE-ValueType
Pfam:DNA_pol_E_B 196 412 1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102923
SMART Domains Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 46 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
low complexity region 113 159 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 264 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
FA58C 375 531 8.72e-46 SMART
Zn_pept 555 983 5.56e-43 SMART
low complexity region 1005 1029 N/A INTRINSIC
low complexity region 1035 1052 N/A INTRINSIC
low complexity region 1069 1089 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109829
SMART Domains Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
FA58C 1 151 2.04e-37 SMART
Zn_pept 175 603 5.56e-43 SMART
low complexity region 625 649 N/A INTRINSIC
low complexity region 655 672 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141907
Predicted Effect probably benign
Transcript: ENSMUST00000153995
AA Change: Q86K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122906
Gene: ENSMUSG00000020471
AA Change: Q86K

DomainStartEndE-ValueType
PDB:3E0J|G 1 241 1e-142 PDB
Meta Mutation Damage Score 0.0931 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 50-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein is required for the stimulation of DNA polymerase delta activity by the processivity cofactor proliferating cell nuclear antigen (PCNA). Expression of this gene may be a marker for ovarian carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Pold2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pold2 APN 11 5872412 missense probably benign 0.00
IGL00784:Pold2 APN 11 5872412 missense probably benign 0.00
IGL01014:Pold2 APN 11 5872293 missense probably benign
R0056:Pold2 UTSW 11 5872338 missense possibly damaging 0.82
R0111:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R0392:Pold2 UTSW 11 5876776 missense possibly damaging 0.57
R1496:Pold2 UTSW 11 5874175 missense possibly damaging 0.91
R1521:Pold2 UTSW 11 5876833 missense probably damaging 0.99
R1835:Pold2 UTSW 11 5873454 missense possibly damaging 0.56
R1836:Pold2 UTSW 11 5873454 missense possibly damaging 0.56
R2032:Pold2 UTSW 11 5876757 missense probably benign
R2055:Pold2 UTSW 11 5873516 nonsense probably null
R5288:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5384:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5385:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5469:Pold2 UTSW 11 5873048 missense probably damaging 1.00
R5470:Pold2 UTSW 11 5873048 missense probably damaging 1.00
R6232:Pold2 UTSW 11 5873691 missense probably benign 0.03
R7147:Pold2 UTSW 11 5873095 missense probably benign 0.41
R7886:Pold2 UTSW 11 5872714 missense probably damaging 1.00
R8147:Pold2 UTSW 11 5876842 missense probably benign
R8353:Pold2 UTSW 11 5875104 missense probably damaging 0.99
R8453:Pold2 UTSW 11 5875104 missense probably damaging 0.99
R9022:Pold2 UTSW 11 5874121 missense probably benign 0.00
R9564:Pold2 UTSW 11 5874163 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTGCCTTTCAGTTTGATACGCTGC -3'
(R):5'- AGACCTCCCCAGTCTCTTTGGATG -3'

Sequencing Primer
(F):5'- TATGAAGTGGCACTACAATCCCTG -3'
(R):5'- CCAGTCTCTTTGGATGTTTGGTG -3'
Posted On 2014-01-05