Incidental Mutation 'R1131:Gata4'
ID94654
Institutional Source Beutler Lab
Gene Symbol Gata4
Ensembl Gene ENSMUSG00000021944
Gene NameGATA binding protein 4
SynonymsGata-4
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63198922-63271692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63204740 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 210 (F210S)
Ref Sequence ENSEMBL: ENSMUSP00000113891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067417] [ENSMUST00000118022] [ENSMUST00000121312]
Predicted Effect probably benign
Transcript: ENSMUST00000067417
AA Change: F211S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066927
Gene: ENSMUSG00000021944
AA Change: F211S

DomainStartEndE-ValueType
Pfam:GATA-N 1 204 2.2e-54 PFAM
ZnF_GATA 211 261 4.36e-18 SMART
ZnF_GATA 265 315 1.02e-23 SMART
low complexity region 342 360 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118022
AA Change: F210S

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113891
Gene: ENSMUSG00000021944
AA Change: F210S

DomainStartEndE-ValueType
Pfam:GATA-N 1 207 7.8e-54 PFAM
ZnF_GATA 210 260 4.36e-18 SMART
ZnF_GATA 264 314 1.02e-23 SMART
low complexity region 341 359 N/A INTRINSIC
low complexity region 372 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121312
AA Change: F5S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113451
Gene: ENSMUSG00000021944
AA Change: F5S

DomainStartEndE-ValueType
ZnF_GATA 5 55 4.36e-18 SMART
ZnF_GATA 59 109 1.02e-23 SMART
low complexity region 136 154 N/A INTRINSIC
low complexity region 167 184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in ventral morphogenesis, lack a primitive heart tube and foregut, develop partially outside the yolk sac, and die by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Gata4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Gata4 APN 14 63200463 missense possibly damaging 0.53
IGL02481:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02483:Gata4 APN 14 63200461 missense probably benign 0.01
IGL02643:Gata4 APN 14 63204755 missense possibly damaging 0.85
R0034:Gata4 UTSW 14 63201484 missense probably benign 0.00
R0043:Gata4 UTSW 14 63203301 splice site probably benign
R1880:Gata4 UTSW 14 63204695 missense probably damaging 1.00
R3500:Gata4 UTSW 14 63200533 missense possibly damaging 0.84
R3949:Gata4 UTSW 14 63240697 missense possibly damaging 0.95
R4893:Gata4 UTSW 14 63201596 missense probably benign 0.01
R4976:Gata4 UTSW 14 63203689 missense probably damaging 1.00
R5152:Gata4 UTSW 14 63241121 missense probably damaging 1.00
R5198:Gata4 UTSW 14 63200451 missense probably benign 0.09
R5237:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5291:Gata4 UTSW 14 63240599 missense probably damaging 0.98
R5358:Gata4 UTSW 14 63240626 missense probably benign 0.28
R5693:Gata4 UTSW 14 63241145 missense probably damaging 1.00
R7143:Gata4 UTSW 14 63204617 missense probably damaging 1.00
R7299:Gata4 UTSW 14 63203742 missense probably damaging 1.00
R7729:Gata4 UTSW 14 63240737 missense probably benign 0.00
R7849:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
R7932:Gata4 UTSW 14 63204725 missense possibly damaging 0.92
Z1177:Gata4 UTSW 14 63200382 missense probably damaging 0.99
Z1177:Gata4 UTSW 14 63241265 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTCAAGCCTCAAAGCCAAGTTC -3'
(R):5'- CTTAAACAGCCCTGGATGGCAGAG -3'

Sequencing Primer
(F):5'- CGGACCTAAGCTATAGAGATGCTC -3'
(R):5'- AGAGTGGAACCCACTGGC -3'
Posted On2014-01-05