Incidental Mutation 'R1023:Taf1b'
ID 94657
Institutional Source Beutler Lab
Gene Symbol Taf1b
Ensembl Gene ENSMUSG00000059669
Gene Name TATA-box binding protein associated factor, RNA polymerase I, B
Synonyms A230108M10Rik, mTAFI68, p63, 4930408G01Rik
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock # R1023 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 24498359-24558539 bp(+) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) G to T at 24509559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075954] [ENSMUST00000221372] [ENSMUST00000222710]
AlphaFold P97358
Predicted Effect probably benign
Transcript: ENSMUST00000075954
SMART Domains Protein: ENSMUSP00000075339
Gene: ENSMUSG00000059669

DomainStartEndE-ValueType
Pfam:RRN7 3 39 7.3e-15 PFAM
low complexity region 141 153 N/A INTRINSIC
low complexity region 361 374 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
low complexity region 574 583 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220562
Predicted Effect probably benign
Transcript: ENSMUST00000221372
Predicted Effect probably benign
Transcript: ENSMUST00000222710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223503
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes one of the SL1-specific TAFs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Taf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Taf1b APN 12 24547067 missense possibly damaging 0.86
IGL01460:Taf1b APN 12 24558246 missense possibly damaging 0.96
IGL02100:Taf1b APN 12 24544395 missense possibly damaging 0.96
IGL02305:Taf1b APN 12 24544271 missense possibly damaging 0.73
IGL02729:Taf1b APN 12 24547625 splice site probably benign
PIT4283001:Taf1b UTSW 12 24547595 missense possibly damaging 0.86
PIT4519001:Taf1b UTSW 12 24547119 nonsense probably null
R0350:Taf1b UTSW 12 24514885 missense possibly damaging 0.85
R0853:Taf1b UTSW 12 24514828 missense probably benign 0.06
R1604:Taf1b UTSW 12 24556624 missense probably benign
R1702:Taf1b UTSW 12 24509126 missense possibly damaging 0.73
R1743:Taf1b UTSW 12 24547178 missense possibly damaging 0.85
R1817:Taf1b UTSW 12 24547122 missense possibly damaging 0.70
R1873:Taf1b UTSW 12 24556669 missense possibly damaging 0.96
R4595:Taf1b UTSW 12 24500442 missense possibly damaging 0.85
R5280:Taf1b UTSW 12 24549438 missense probably benign 0.18
R5838:Taf1b UTSW 12 24500449 missense possibly damaging 0.92
R5849:Taf1b UTSW 12 24500525 missense probably damaging 1.00
R6368:Taf1b UTSW 12 24558257 missense possibly damaging 0.53
R6529:Taf1b UTSW 12 24556651 missense possibly damaging 0.53
R6589:Taf1b UTSW 12 24556528 missense possibly damaging 0.72
R6879:Taf1b UTSW 12 24500517 missense possibly damaging 0.71
R7342:Taf1b UTSW 12 24558344 nonsense probably null
R7449:Taf1b UTSW 12 24504993 missense probably benign 0.33
R8912:Taf1b UTSW 12 24516861 missense possibly damaging 0.73
R9239:Taf1b UTSW 12 24556016 missense probably damaging 1.00
R9337:Taf1b UTSW 12 24547122 missense possibly damaging 0.70
R9510:Taf1b UTSW 12 24516948 missense possibly damaging 0.85
R9780:Taf1b UTSW 12 24514819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCCTGTGTGGATGTCACC -3'
(R):5'- TGACCCCAATGCTGCAAAACAAGTAA -3'

Sequencing Primer
(F):5'- TGTGGATGTCACCATCACTTG -3'
(R):5'- gccttgatgataatggactgaac -3'
Posted On 2014-01-05