Mutagenetix > Incidental Mutation

Incidental Mutation 'R1023:Wdr60'

94661

Institutional Source

Beutler Lab

Gene Symbol

Wdr60

Ensembl Gene

ENSMUSG00000042050

Gene Name

WD repeat domain 60

Synonyms

D430033N04Rik

MMRRC Submission

039125-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1023 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116206262-116263022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116232657 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 490 (E490G)

Ref Sequence

ENSEMBL: ENSMUSP00000047334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039349]

AlphaFold

Q8C761

Predicted Effect

probably damaging
Transcript: ENSMUST00000039349
AA Change: E490G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: E490G

Domain	Start	End	E-Value	Type
coiled coil region	84	122	N/A	INTRINSIC
low complexity region	168	193	N/A	INTRINSIC
low complexity region	226	242	N/A	INTRINSIC
coiled coil region	280	309	N/A	INTRINSIC
low complexity region	319	337	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
WD40	629	668	2.77e-1	SMART
Blast:WD40	694	755	2e-7	BLAST
WD40	846	881	3.84e0	SMART
WD40	884	926	5.55e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222764

Meta Mutation Damage Score

0.2117

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,066,871	A607V	probably damaging	Het
4930523C07Rik	A	G	1: 160,077,487		probably benign	Het
Ap3d1	A	T	10: 80,714,258	L713Q	probably damaging	Het
Baz2a	A	G	10: 128,121,807	T1010A	possibly damaging	Het
Cd163l1	T	A	7: 140,224,463	C484S	possibly damaging	Het
Cdh15	T	C	8: 122,865,200	I608T	probably damaging	Het
Cdkl2	A	T	5: 92,039,286	D40E	possibly damaging	Het
Col9a2	G	A	4: 121,044,010	G118R	unknown	Het
Cryge	C	A	1: 65,050,786	C79F	probably damaging	Het
Dapk1	T	C	13: 60,730,985	L596P	probably damaging	Het
Dqx1	G	A	6: 83,061,089	C486Y	probably damaging	Het
Enam	A	G	5: 88,501,967	Q445R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gnpat	A	T	8: 124,870,780	D27V	probably benign	Het
Htr5a	A	T	5: 27,842,998	T184S	possibly damaging	Het
Lap3	C	T	5: 45,495,211	P50S	probably benign	Het
Mamdc2	A	T	19: 23,310,907	M589K	probably damaging	Het
Mast4	A	G	13: 102,735,496	S2263P	probably benign	Het
Mef2b	C	T	8: 70,165,597	P109L	possibly damaging	Het
Meltf	T	A	16: 31,884,960	F168L	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Nup205	T	A	6: 35,234,706	F1661I	probably damaging	Het
Olfr187	A	T	16: 59,035,815	N307K	probably benign	Het
Olfr747	A	T	14: 50,681,016	L206H	probably damaging	Het
Plac8	A	T	5: 100,556,581	D83E	probably benign	Het
Pnpt1	T	C	11: 29,141,328		probably benign	Het
Pold2	G	T	11: 5,875,140	Q86K	probably benign	Het
Ptprt	A	G	2: 161,558,943	L1057P	probably damaging	Het
Rev3l	A	G	10: 39,832,639	H2284R	probably damaging	Het
Skint6	A	C	4: 113,238,103	S120A	probably benign	Het
Slc1a7	G	A	4: 108,007,573	V270M	probably damaging	Het
Spata2	A	G	2: 167,485,222	M85T	probably benign	Het
Taf1b	G	T	12: 24,509,559		probably benign	Het
Tert	A	G	13: 73,642,059	N844S	probably benign	Het
Thrap3	G	A	4: 126,180,089	S288L	possibly damaging	Het
Ubap2l	A	G	3: 90,047,873		probably benign	Het
Ubtf	T	C	11: 102,311,450	E197G	possibly damaging	Het
Usp20	G	T	2: 31,007,813	G216W	probably damaging	Het
Yy1	T	A	12: 108,793,531	V40E	unknown	Het
Zfp335	G	A	2: 164,892,585	H1254Y	possibly damaging	Het

Other mutations in Wdr60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Wdr60	APN	12	116241780	missense	probably benign	0.01
IGL00668:Wdr60	APN	12	116257428	missense	probably benign	0.32
IGL00914:Wdr60	APN	12	116232603	missense	probably damaging	1.00
IGL01061:Wdr60	APN	12	116229704	missense	probably benign	0.45
IGL01375:Wdr60	APN	12	116229676	missense	possibly damaging	0.91
IGL01758:Wdr60	APN	12	116218798	missense	possibly damaging	0.82
IGL01930:Wdr60	APN	12	116225963	critical splice donor site	probably null
IGL02028:Wdr60	APN	12	116256061	missense	probably benign	0.06
IGL03180:Wdr60	APN	12	116218865	missense	probably benign	0.07
F5770:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
R0153:Wdr60	UTSW	12	116232636	missense	probably benign	0.01
R0265:Wdr60	UTSW	12	116257406	splice site	probably benign
R0364:Wdr60	UTSW	12	116257477	splice site	probably benign
R0601:Wdr60	UTSW	12	116255935	missense	possibly damaging	0.79
R0624:Wdr60	UTSW	12	116248290	missense	probably damaging	0.98
R0755:Wdr60	UTSW	12	116211792	missense	probably benign	0.01
R1065:Wdr60	UTSW	12	116256076	missense	probably damaging	0.98
R1543:Wdr60	UTSW	12	116231784	splice site	probably benign
R1663:Wdr60	UTSW	12	116229610	missense	probably benign	0.01
R1678:Wdr60	UTSW	12	116225970	missense	probably damaging	1.00
R1719:Wdr60	UTSW	12	116255912	missense	probably benign
R1755:Wdr60	UTSW	12	116226029	missense	probably damaging	0.98
R1832:Wdr60	UTSW	12	116207743	missense	probably damaging	0.99
R1918:Wdr60	UTSW	12	116232601	missense	probably damaging	0.96
R2291:Wdr60	UTSW	12	116229571	splice site	probably null
R2444:Wdr60	UTSW	12	116232669	missense	possibly damaging	0.93
R3419:Wdr60	UTSW	12	116224977	missense	probably benign	0.05
R3699:Wdr60	UTSW	12	116211842	nonsense	probably null
R3700:Wdr60	UTSW	12	116211842	nonsense	probably null
R4445:Wdr60	UTSW	12	116207715	missense	probably damaging	1.00
R4664:Wdr60	UTSW	12	116256211	missense	probably damaging	0.99
R4954:Wdr60	UTSW	12	116256025	missense	probably damaging	1.00
R5057:Wdr60	UTSW	12	116213413	missense	probably benign	0.43
R5163:Wdr60	UTSW	12	116255866	missense	possibly damaging	0.76
R5341:Wdr60	UTSW	12	116255914	missense	possibly damaging	0.51
R5560:Wdr60	UTSW	12	116218113	missense	probably damaging	0.98
R5870:Wdr60	UTSW	12	116256245	missense	possibly damaging	0.94
R5925:Wdr60	UTSW	12	116233394	missense	possibly damaging	0.82
R6223:Wdr60	UTSW	12	116257458	missense	possibly damaging	0.95
R6364:Wdr60	UTSW	12	116241732	missense	probably damaging	1.00
R6450:Wdr60	UTSW	12	116246727	nonsense	probably null
R6462:Wdr60	UTSW	12	116229631	missense	probably benign
R6751:Wdr60	UTSW	12	116213456	missense	possibly damaging	0.52
R6896:Wdr60	UTSW	12	116229671	missense	possibly damaging	0.52
R6962:Wdr60	UTSW	12	116211778	missense	probably damaging	1.00
R7033:Wdr60	UTSW	12	116211891	missense	probably benign	0.03
R7042:Wdr60	UTSW	12	116254441	missense	probably benign	0.02
R7254:Wdr60	UTSW	12	116262585	intron	probably benign
R7567:Wdr60	UTSW	12	116254510	splice site	probably null
R7889:Wdr60	UTSW	12	116255939	nonsense	probably null
R8082:Wdr60	UTSW	12	116213507	critical splice acceptor site	probably null
R8288:Wdr60	UTSW	12	116213725	missense	probably damaging	1.00
R8309:Wdr60	UTSW	12	116256085	missense	probably damaging	1.00
R8682:Wdr60	UTSW	12	116224990	missense	probably damaging	1.00
R8683:Wdr60	UTSW	12	116229642	missense	probably benign	0.03
R8699:Wdr60	UTSW	12	116207701	missense	probably benign	0.01
R8782:Wdr60	UTSW	12	116241712	missense	probably damaging	1.00
R8809:Wdr60	UTSW	12	116229614	missense	probably damaging	0.98
R9281:Wdr60	UTSW	12	116248057	nonsense	probably null
R9530:Wdr60	UTSW	12	116211791	missense	possibly damaging	0.87
R9751:Wdr60	UTSW	12	116241783	critical splice acceptor site	probably null
V7581:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7582:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7583:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
X0063:Wdr60	UTSW	12	116255869	missense	probably benign
Z1177:Wdr60	UTSW	12	116246099	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGATCAGACTAGGGTTCAGGCCAAT -3'
(R):5'- AGTCTAACATAGCCTCTTGGGGCAT -3'

Sequencing Primer
(F):5'- GACTAGGGTTCAGGCCAATTTAATG -3'
(R):5'- acatccgcagtcagaagag -3'

Posted On

2014-01-05