Mutagenetix > Incidental Mutations

Incidental Mutation 'R1023:Meltf'

94672

Institutional Source

Beutler Lab

Gene Symbol

Meltf

Ensembl Gene

ENSMUSG00000022780

Gene Name

melanotransferrin

Synonyms

MTf, CD228, melanotransferrin, Mfi2

MMRRC Submission

039125-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1023 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31878810-31899020 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31884960 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 168 (F168L)

Ref Sequence

ENSEMBL: ENSMUSP00000023464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023464]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023464
AA Change: F168L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780
AA Change: F168L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
TR_FER	23	364	2.62e-183	SMART
TR_FER	366	719	4.23e-178	SMART
low complexity region	721	734	N/A	INTRINSIC

Meta Mutation Damage Score

0.7982

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, exhibit no physical defects, and develop normally with no detectable alterations in iron metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,066,871	A607V	probably damaging	Het
4930523C07Rik	A	G	1: 160,077,487		probably benign	Het
Ap3d1	A	T	10: 80,714,258	L713Q	probably damaging	Het
Baz2a	A	G	10: 128,121,807	T1010A	possibly damaging	Het
Cd163l1	T	A	7: 140,224,463	C484S	possibly damaging	Het
Cdh15	T	C	8: 122,865,200	I608T	probably damaging	Het
Cdkl2	A	T	5: 92,039,286	D40E	possibly damaging	Het
Col9a2	G	A	4: 121,044,010	G118R	unknown	Het
Cryge	C	A	1: 65,050,786	C79F	probably damaging	Het
Dapk1	T	C	13: 60,730,985	L596P	probably damaging	Het
Dqx1	G	A	6: 83,061,089	C486Y	probably damaging	Het
Enam	A	G	5: 88,501,967	Q445R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gnpat	A	T	8: 124,870,780	D27V	probably benign	Het
Htr5a	A	T	5: 27,842,998	T184S	possibly damaging	Het
Lap3	C	T	5: 45,495,211	P50S	probably benign	Het
Mamdc2	A	T	19: 23,310,907	M589K	probably damaging	Het
Mast4	A	G	13: 102,735,496	S2263P	probably benign	Het
Mef2b	C	T	8: 70,165,597	P109L	possibly damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Nup205	T	A	6: 35,234,706	F1661I	probably damaging	Het
Olfr187	A	T	16: 59,035,815	N307K	probably benign	Het
Olfr747	A	T	14: 50,681,016	L206H	probably damaging	Het
Plac8	A	T	5: 100,556,581	D83E	probably benign	Het
Pnpt1	T	C	11: 29,141,328		probably benign	Het
Pold2	G	T	11: 5,875,140	Q86K	probably benign	Het
Ptprt	A	G	2: 161,558,943	L1057P	probably damaging	Het
Rev3l	A	G	10: 39,832,639	H2284R	probably damaging	Het
Skint6	A	C	4: 113,238,103	S120A	probably benign	Het
Slc1a7	G	A	4: 108,007,573	V270M	probably damaging	Het
Spata2	A	G	2: 167,485,222	M85T	probably benign	Het
Taf1b	G	T	12: 24,509,559		probably benign	Het
Tert	A	G	13: 73,642,059	N844S	probably benign	Het
Thrap3	G	A	4: 126,180,089	S288L	possibly damaging	Het
Ubap2l	A	G	3: 90,047,873		probably benign	Het
Ubtf	T	C	11: 102,311,450	E197G	possibly damaging	Het
Usp20	G	T	2: 31,007,813	G216W	probably damaging	Het
Wdr60	T	C	12: 116,232,657	E490G	probably damaging	Het
Yy1	T	A	12: 108,793,531	V40E	unknown	Het
Zfp335	G	A	2: 164,892,585	H1254Y	possibly damaging	Het

Other mutations in Meltf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01811:Meltf	APN	16	31888985	missense	probably damaging	1.00
IGL02942:Meltf	APN	16	31890778	nonsense	probably null
IGL03340:Meltf	APN	16	31892784	missense	probably damaging	1.00
R0734:Meltf	UTSW	16	31881958	missense	probably damaging	0.99
R1751:Meltf	UTSW	16	31883929	missense	probably damaging	1.00
R1767:Meltf	UTSW	16	31883929	missense	probably damaging	1.00
R1851:Meltf	UTSW	16	31896577	missense	probably benign	0.00
R1900:Meltf	UTSW	16	31881969	critical splice donor site	probably null
R1993:Meltf	UTSW	16	31892622	nonsense	probably null
R3423:Meltf	UTSW	16	31896525	nonsense	probably null
R3425:Meltf	UTSW	16	31896525	nonsense	probably null
R3804:Meltf	UTSW	16	31884998	missense	probably benign	0.23
R4724:Meltf	UTSW	16	31892505	missense	probably benign	0.03
R4976:Meltf	UTSW	16	31894714	missense	probably benign	0.01
R5007:Meltf	UTSW	16	31887562	missense	possibly damaging	0.60
R5058:Meltf	UTSW	16	31887603	splice site	probably null
R5534:Meltf	UTSW	16	31890814	critical splice donor site	probably null
R5661:Meltf	UTSW	16	31881926	missense	possibly damaging	0.65
R6028:Meltf	UTSW	16	31887476	missense	possibly damaging	0.91
R6424:Meltf	UTSW	16	31880262	nonsense	probably null
R6464:Meltf	UTSW	16	31890776	missense	probably benign	0.19
R6479:Meltf	UTSW	16	31881882	missense	probably damaging	1.00
R6525:Meltf	UTSW	16	31888899	nonsense	probably null
R6629:Meltf	UTSW	16	31885076	missense	probably damaging	1.00
R6964:Meltf	UTSW	16	31880162	missense	probably benign	0.41
R7133:Meltf	UTSW	16	31892799	missense	probably damaging	1.00
R7169:Meltf	UTSW	16	31880162	missense	probably benign	0.41
R7198:Meltf	UTSW	16	31883799	missense	possibly damaging	0.61
R7212:Meltf	UTSW	16	31890814	critical splice donor site	probably null
R7246:Meltf	UTSW	16	31894862	missense	probably damaging	1.00
R7407:Meltf	UTSW	16	31894735	missense	probably damaging	1.00
R7424:Meltf	UTSW	16	31884946	missense	probably damaging	1.00
R7475:Meltf	UTSW	16	31881938	missense	probably benign	0.12
R7727:Meltf	UTSW	16	31883794	missense	probably damaging	0.99
R7764:Meltf	UTSW	16	31880267	missense	probably benign	0.01
R8840:Meltf	UTSW	16	31897202	missense	probably damaging	0.98
X0062:Meltf	UTSW	16	31880200	missense	probably damaging	1.00
Z1177:Meltf	UTSW	16	31880234	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCAGACAGCTTGACTGCCTCTTC -3'
(R):5'- ATGCTCTACAGCCCAAAGTCACTTC -3'

Sequencing Primer
(F):5'- GGCCACTGTTCTGAAAATGAACTC -3'
(R):5'- AAAGTCACTTCCCTGCGCC -3'

Posted On

2014-01-05