Incidental Mutation 'R1023:Olfr187'
ID 94674
Institutional Source Beutler Lab
Gene Symbol Olfr187
Ensembl Gene ENSMUSG00000043357
Gene Name olfactory receptor 187
Synonyms GA_x54KRFPKG5P-55265713-55264787, MOR183-8
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R1023 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 59035563-59039767 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59035815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 307 (N307K)
Ref Sequence ENSEMBL: ENSMUSP00000147035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000206428] [ENSMUST00000207673]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054385
AA Change: N307K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052477
Gene: ENSMUSG00000043357
AA Change: N307K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2e-50 PFAM
Pfam:7tm_1 40 289 8.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206408
Predicted Effect probably benign
Transcript: ENSMUST00000206428
AA Change: N307K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000207673
AA Change: N307K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1333 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Olfr187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Olfr187 APN 16 59035906 missense probably damaging 1.00
R0218:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R1086:Olfr187 UTSW 16 59036263 missense probably damaging 1.00
R1472:Olfr187 UTSW 16 59036557 missense probably damaging 1.00
R4710:Olfr187 UTSW 16 59036275 missense possibly damaging 0.94
R4738:Olfr187 UTSW 16 59036195 missense probably benign 0.00
R5265:Olfr187 UTSW 16 59036143 missense possibly damaging 0.94
R6053:Olfr187 UTSW 16 59035988 missense probably damaging 1.00
R6704:Olfr187 UTSW 16 59035862 missense probably damaging 1.00
R6854:Olfr187 UTSW 16 59036065 missense possibly damaging 0.75
R7178:Olfr187 UTSW 16 59035933 missense probably benign 0.06
R7198:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R7404:Olfr187 UTSW 16 59036240 missense possibly damaging 0.81
R7462:Olfr187 UTSW 16 59036016 nonsense probably null
R7938:Olfr187 UTSW 16 59035962 nonsense probably null
R8785:Olfr187 UTSW 16 59036167 missense probably damaging 1.00
R8790:Olfr187 UTSW 16 59036217 missense possibly damaging 0.96
R8912:Olfr187 UTSW 16 59035900 missense probably benign 0.21
R9198:Olfr187 UTSW 16 59035900 missense probably benign 0.21
R9234:Olfr187 UTSW 16 59036426 missense probably benign 0.05
R9368:Olfr187 UTSW 16 59036315 missense probably benign 0.04
R9568:Olfr187 UTSW 16 59035850 missense probably damaging 1.00
R9679:Olfr187 UTSW 16 59036158 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCCTCCTCTGCACAGGTAAATGT -3'
(R):5'- TCTGGCTCGATCCAGGTTTTCACTA -3'

Sequencing Primer
(F):5'- CTTGCATAGCTACACTGAAAAAGAG -3'
(R):5'- AGAAAGCCTTCTCCACCTGTG -3'
Posted On 2014-01-05