Mutagenetix > Incidental Mutations

Incidental Mutation 'R1023:Olfr187'

94674

Institutional Source

Beutler Lab

Gene Symbol

Olfr187

Ensembl Gene

ENSMUSG00000043357

Gene Name

olfactory receptor 187

Synonyms

GA_x54KRFPKG5P-55265713-55264787, MOR183-8

MMRRC Submission

039125-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R1023 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59035563-59039767 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59035815 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 307 (N307K)

Ref Sequence

ENSEMBL: ENSMUSP00000147035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000206428] [ENSMUST00000207673]

Predicted Effect

probably benign
Transcript: ENSMUST00000054385
AA Change: N307K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000052477
Gene: ENSMUSG00000043357
AA Change: N307K

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	307	2e-50	PFAM
Pfam:7tm_1	40	289	8.7e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206408

Predicted Effect

probably benign
Transcript: ENSMUST00000206428
AA Change: N307K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000207673
AA Change: N307K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.1333

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,066,871	A607V	probably damaging	Het
4930523C07Rik	A	G	1: 160,077,487		probably benign	Het
Ap3d1	A	T	10: 80,714,258	L713Q	probably damaging	Het
Baz2a	A	G	10: 128,121,807	T1010A	possibly damaging	Het
Cd163l1	T	A	7: 140,224,463	C484S	possibly damaging	Het
Cdh15	T	C	8: 122,865,200	I608T	probably damaging	Het
Cdkl2	A	T	5: 92,039,286	D40E	possibly damaging	Het
Col9a2	G	A	4: 121,044,010	G118R	unknown	Het
Cryge	C	A	1: 65,050,786	C79F	probably damaging	Het
Dapk1	T	C	13: 60,730,985	L596P	probably damaging	Het
Dqx1	G	A	6: 83,061,089	C486Y	probably damaging	Het
Enam	A	G	5: 88,501,967	Q445R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gnpat	A	T	8: 124,870,780	D27V	probably benign	Het
Htr5a	A	T	5: 27,842,998	T184S	possibly damaging	Het
Lap3	C	T	5: 45,495,211	P50S	probably benign	Het
Mamdc2	A	T	19: 23,310,907	M589K	probably damaging	Het
Mast4	A	G	13: 102,735,496	S2263P	probably benign	Het
Mef2b	C	T	8: 70,165,597	P109L	possibly damaging	Het
Meltf	T	A	16: 31,884,960	F168L	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Nup205	T	A	6: 35,234,706	F1661I	probably damaging	Het
Olfr747	A	T	14: 50,681,016	L206H	probably damaging	Het
Plac8	A	T	5: 100,556,581	D83E	probably benign	Het
Pnpt1	T	C	11: 29,141,328		probably benign	Het
Pold2	G	T	11: 5,875,140	Q86K	probably benign	Het
Ptprt	A	G	2: 161,558,943	L1057P	probably damaging	Het
Rev3l	A	G	10: 39,832,639	H2284R	probably damaging	Het
Skint6	A	C	4: 113,238,103	S120A	probably benign	Het
Slc1a7	G	A	4: 108,007,573	V270M	probably damaging	Het
Spata2	A	G	2: 167,485,222	M85T	probably benign	Het
Taf1b	G	T	12: 24,509,559		probably benign	Het
Tert	A	G	13: 73,642,059	N844S	probably benign	Het
Thrap3	G	A	4: 126,180,089	S288L	possibly damaging	Het
Ubap2l	A	G	3: 90,047,873		probably benign	Het
Ubtf	T	C	11: 102,311,450	E197G	possibly damaging	Het
Usp20	G	T	2: 31,007,813	G216W	probably damaging	Het
Wdr60	T	C	12: 116,232,657	E490G	probably damaging	Het
Yy1	T	A	12: 108,793,531	V40E	unknown	Het
Zfp335	G	A	2: 164,892,585	H1254Y	possibly damaging	Het

Other mutations in Olfr187

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Olfr187	APN	16	59035906	missense	probably damaging	1.00
R0218:Olfr187	UTSW	16	59036093	missense	probably benign	0.00
R1086:Olfr187	UTSW	16	59036263	missense	probably damaging	1.00
R1472:Olfr187	UTSW	16	59036557	missense	probably damaging	1.00
R4710:Olfr187	UTSW	16	59036275	missense	possibly damaging	0.94
R4738:Olfr187	UTSW	16	59036195	missense	probably benign	0.00
R5265:Olfr187	UTSW	16	59036143	missense	possibly damaging	0.94
R6053:Olfr187	UTSW	16	59035988	missense	probably damaging	1.00
R6704:Olfr187	UTSW	16	59035862	missense	probably damaging	1.00
R6854:Olfr187	UTSW	16	59036065	missense	possibly damaging	0.75
R7178:Olfr187	UTSW	16	59035933	missense	probably benign	0.06
R7198:Olfr187	UTSW	16	59036093	missense	probably benign	0.00
R7404:Olfr187	UTSW	16	59036240	missense	possibly damaging	0.81
R7462:Olfr187	UTSW	16	59036016	nonsense	probably null
R7938:Olfr187	UTSW	16	59035962	nonsense	probably null
R8785:Olfr187	UTSW	16	59036167	missense	probably damaging	1.00
R8790:Olfr187	UTSW	16	59036217	missense	possibly damaging	0.96
R8912:Olfr187	UTSW	16	59035900	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- TGCCTCCTCTGCACAGGTAAATGT -3'
(R):5'- TCTGGCTCGATCCAGGTTTTCACTA -3'

Sequencing Primer
(F):5'- CTTGCATAGCTACACTGAAAAAGAG -3'
(R):5'- AGAAAGCCTTCTCCACCTGTG -3'

Posted On

2014-01-05