Incidental Mutation 'R1132:Selenbp1'
ID94675
Institutional Source Beutler Lab
Gene Symbol Selenbp1
Ensembl Gene ENSMUSG00000068874
Gene Nameselenium binding protein 1
SynonymsLp56, Lpsb
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94933056-94944758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 94937333 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 100 (I100M)
Ref Sequence ENSEMBL: ENSMUSP00000118563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090839] [ENSMUST00000134202] [ENSMUST00000140757]
Predicted Effect probably benign
Transcript: ENSMUST00000090839
AA Change: I100M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000088349
Gene: ENSMUSG00000068874
AA Change: I100M

DomainStartEndE-ValueType
Pfam:SBP56 6 472 3.2e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134202
AA Change: I100M

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120159
Gene: ENSMUSG00000068874
AA Change: I100M

DomainStartEndE-ValueType
Pfam:SBP56 6 123 4.7e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139949
Predicted Effect probably benign
Transcript: ENSMUST00000140757
AA Change: I100M

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118563
Gene: ENSMUSG00000068874
AA Change: I100M

DomainStartEndE-ValueType
Pfam:SBP56 6 123 4.7e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145551
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit sex-specific changes in organ weights. Mice homozygous for a different allele lack methanethiol oxidase activity and exhibit an increase in dimethylsulfide and dimethyl-sulfone serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Selenbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Selenbp1 APN 3 94937002 missense probably benign 0.24
IGL03281:Selenbp1 APN 3 94937310 nonsense probably null
PIT4131001:Selenbp1 UTSW 3 94937296 missense probably damaging 0.99
R0415:Selenbp1 UTSW 3 94936913 missense possibly damaging 0.61
R1421:Selenbp1 UTSW 3 94943872 missense probably benign
R1522:Selenbp1 UTSW 3 94937358 missense probably damaging 1.00
R1676:Selenbp1 UTSW 3 94944543 missense probably damaging 1.00
R1701:Selenbp1 UTSW 3 94937390 missense probably damaging 1.00
R2152:Selenbp1 UTSW 3 94944130 missense probably damaging 1.00
R3033:Selenbp1 UTSW 3 94938040 missense probably benign 0.22
R4363:Selenbp1 UTSW 3 94942749 splice site probably null
R4631:Selenbp1 UTSW 3 94944568 makesense probably null
R4798:Selenbp1 UTSW 3 94943900 missense probably benign 0.27
R4935:Selenbp1 UTSW 3 94937958 missense probably benign 0.10
R5464:Selenbp1 UTSW 3 94944416 missense probably benign
R6253:Selenbp1 UTSW 3 94943846 missense possibly damaging 0.95
R6314:Selenbp1 UTSW 3 94937265 missense probably damaging 1.00
R7199:Selenbp1 UTSW 3 94944434 missense possibly damaging 0.79
R7330:Selenbp1 UTSW 3 94939710 missense probably benign
R7637:Selenbp1 UTSW 3 94937348 nonsense probably null
R7658:Selenbp1 UTSW 3 94944102 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTGAACTGAAACCCTGTCTATGCC -3'
(R):5'- CAGCCCATGCTTGAAACTTGCTTG -3'

Sequencing Primer
(F):5'- CCCTGTCTATGCCTAGTCAAAAATG -3'
(R):5'- AGTTCAGGAGCCCTCTGAAG -3'
Posted On2014-01-05