Incidental Mutation 'R1132:Vmn1r22'
ID94697
Institutional Source Beutler Lab
Gene Symbol Vmn1r22
Ensembl Gene ENSMUSG00000115091
Gene Namevomeronasal 1 receptor 22
SynonymsV1rc23
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57898126-57908028 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57900841 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 50 (I50M)
Ref Sequence ENSEMBL: ENSMUSP00000154301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177435] [ENSMUST00000227342] [ENSMUST00000227650] [ENSMUST00000228076] [ENSMUST00000228257] [ENSMUST00000228322] [ENSMUST00000228905]
Predicted Effect probably benign
Transcript: ENSMUST00000177435
AA Change: I50M

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135207
Gene: ENSMUSG00000114982
AA Change: I50M

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227342
Predicted Effect probably benign
Transcript: ENSMUST00000227650
AA Change: I50M

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228076
AA Change: I50M

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228257
AA Change: I50M

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228322
AA Change: I50M

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228905
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Vmn1r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Vmn1r22 UTSW 6 57900528 missense probably benign 0.06
R0415:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
R1609:Vmn1r22 UTSW 6 57900748 nonsense probably null
R1666:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1668:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1708:Vmn1r22 UTSW 6 57900496 missense possibly damaging 0.46
R1796:Vmn1r22 UTSW 6 57900149 missense probably damaging 1.00
R2359:Vmn1r22 UTSW 6 57900989 start codon destroyed probably null 1.00
R4600:Vmn1r22 UTSW 6 57900875 missense probably damaging 1.00
R5302:Vmn1r22 UTSW 6 57900975 missense possibly damaging 0.87
R5560:Vmn1r22 UTSW 6 57900738 missense probably damaging 1.00
R6026:Vmn1r22 UTSW 6 57900405 missense probably benign 0.00
R6066:Vmn1r22 UTSW 6 57900879 missense probably benign 0.01
R6343:Vmn1r22 UTSW 6 57900578 missense possibly damaging 0.65
R6639:Vmn1r22 UTSW 6 57900714 missense probably benign 0.01
R7106:Vmn1r22 UTSW 6 57900311 missense probably damaging 1.00
R7683:Vmn1r22 UTSW 6 57900419 missense probably damaging 1.00
R8126:Vmn1r22 UTSW 6 57900684 missense possibly damaging 0.85
S24628:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AACACACCCAGGAGGCATGTGA -3'
(R):5'- GGTATGAGACTCAGGTGAAATGCAGG -3'

Sequencing Primer
(F):5'- TGTGATGCACATAGAGAGTCCTC -3'
(R):5'- CTTGGAGGGTATATAACAATGTAGGC -3'
Posted On2014-01-05