Incidental Mutation 'R1132:Olfr699'
ID94715
Institutional Source Beutler Lab
Gene Symbol Olfr699
Ensembl Gene ENSMUSG00000096714
Gene Nameolfactory receptor 699
SynonymsMOR283-10P, GA_x6K02T2PBJ9-9168355-9167405
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106787963-106793198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106790551 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 150 (I150N)
Ref Sequence ENSEMBL: ENSMUSP00000149112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065024] [ENSMUST00000215952] [ENSMUST00000216307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065024
AA Change: I150N

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068023
Gene: ENSMUSG00000096714
AA Change: I150N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2.1e-5 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215952
AA Change: I150N

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216307
AA Change: I150N

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Olfr699
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr699 APN 7 106790589 missense probably benign 0.12
IGL02093:Olfr699 APN 7 106790823 missense probably benign 0.12
IGL02404:Olfr699 APN 7 106790359 missense probably damaging 1.00
IGL03214:Olfr699 APN 7 106790345 missense probably benign
IGL03230:Olfr699 APN 7 106790704 missense probably damaging 1.00
R0194:Olfr699 UTSW 7 106790823 missense probably benign 0.12
R0523:Olfr699 UTSW 7 106790326 missense probably damaging 1.00
R1373:Olfr699 UTSW 7 106790756 missense probably benign 0.01
R1482:Olfr699 UTSW 7 106790333 missense probably benign 0.00
R1498:Olfr699 UTSW 7 106790416 missense possibly damaging 0.78
R1500:Olfr699 UTSW 7 106790821 missense probably damaging 1.00
R2656:Olfr699 UTSW 7 106790513 missense probably damaging 0.98
R4163:Olfr699 UTSW 7 106790279 missense probably damaging 1.00
R4638:Olfr699 UTSW 7 106790998 start codon destroyed probably null 1.00
R5104:Olfr699 UTSW 7 106790332 missense possibly damaging 0.81
R6216:Olfr699 UTSW 7 106790458 missense probably benign 0.23
R6976:Olfr699 UTSW 7 106790227 missense probably damaging 0.99
R7129:Olfr699 UTSW 7 106790483 missense probably benign 0.00
R7130:Olfr699 UTSW 7 106790182 missense probably benign 0.35
R8104:Olfr699 UTSW 7 106791130 start gained probably benign
R8104:Olfr699 UTSW 7 106791131 start gained probably benign
Z1177:Olfr699 UTSW 7 106790270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGAGCCCCATAGTACAGACC -3'
(R):5'- GCCCTTCAGATGTTCCTAGCACTG -3'

Sequencing Primer
(F):5'- TAGTACAGACCAACTACTGTCAAGTG -3'
(R):5'- AGATGTTCCTAGCACTGACACTTG -3'
Posted On2014-01-05