Incidental Mutation 'R1132:Dnah3'
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119939004 bp
Amino Acid Change Lysine to Arginine at position 3586 (K3586R)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000207270] [ENSMUST00000208424] [ENSMUST00000208701] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046993
AA Change: K3586R

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: K3586R

low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207680
Predicted Effect probably benign
Transcript: ENSMUST00000208424
Predicted Effect probably benign
Transcript: ENSMUST00000208701
AA Change: K607R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: K3575R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1687:Dnah3 UTSW 7 120045786 splice site probably null
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4785:Dnah3 UTSW 7 119967824 missense probably benign 0.29
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 splice site probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5789:Dnah3 UTSW 7 119943599 missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6004:Dnah3 UTSW 7 120086297 missense probably benign 0.10
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6237:Dnah3 UTSW 7 120009384 missense probably damaging 1.00
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 splice site probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7222:Dnah3 UTSW 7 120071523 missense probably benign 0.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7313:Dnah3 UTSW 7 119981344 missense probably benign 0.39
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7368:Dnah3 UTSW 7 120029016 missense probably benign
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
R7431:Dnah3 UTSW 7 120051744 missense probably damaging 1.00
R7499:Dnah3 UTSW 7 120060912 missense probably damaging 0.99
R7515:Dnah3 UTSW 7 120073592 missense probably benign 0.21
R7564:Dnah3 UTSW 7 119971594 missense probably benign
R7618:Dnah3 UTSW 7 119978378 missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119967434 missense
R7728:Dnah3 UTSW 7 119938828 missense probably damaging 1.00
R7757:Dnah3 UTSW 7 120071570 missense probably benign
R7757:Dnah3 UTSW 7 119971215 splice site probably null
R7774:Dnah3 UTSW 7 119951752 nonsense probably null
R7804:Dnah3 UTSW 7 119952618 missense probably damaging 1.00
R7804:Dnah3 UTSW 7 120011012 missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119951704 missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119967552 missense
R7903:Dnah3 UTSW 7 120042128 missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119951271 missense probably damaging 0.97
R7989:Dnah3 UTSW 7 120077789 missense probably benign
R8142:Dnah3 UTSW 7 120060966 missense probably benign 0.00
R8164:Dnah3 UTSW 7 119967614 missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119926413 missense probably benign 0.01
R8313:Dnah3 UTSW 7 119951152 missense probably benign 0.38
R8338:Dnah3 UTSW 7 120071881 missense probably benign 0.01
R8355:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
R8408:Dnah3 UTSW 7 119952505 missense probably damaging 1.00
R8411:Dnah3 UTSW 7 120011030 missense probably damaging 1.00
R8455:Dnah3 UTSW 7 119952208 missense probably damaging 1.00
R8483:Dnah3 UTSW 7 119937030 missense probably benign 0.00
R8531:Dnah3 UTSW 7 119951368 missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1176:Dnah3 UTSW 7 119967803 missense
Z1177:Dnah3 UTSW 7 119967901 missense probably damaging 0.99
Z1177:Dnah3 UTSW 7 120007862 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- catatactgtctgtgtctagtttGAG -3'
Posted On2014-01-05