Incidental Mutation 'R1132:Prdm4'
ID94736
Institutional Source Beutler Lab
Gene Symbol Prdm4
Ensembl Gene ENSMUSG00000035529
Gene NamePR domain containing 4
Synonyms2810470D21Rik, SC-1, 1700031E19Rik
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85891966-85917142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85899281 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 666 (S666P)
Ref Sequence ENSEMBL: ENSMUSP00000151931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037646] [ENSMUST00000219370] [ENSMUST00000220032]
Predicted Effect probably damaging
Transcript: ENSMUST00000037646
AA Change: S659P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041942
Gene: ENSMUSG00000035529
AA Change: S659P

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 339 353 N/A INTRINSIC
PDB:3DB5|B 386 543 2e-98 PDB
Blast:SET 408 538 5e-82 BLAST
ZnF_C2H2 548 569 7.77e1 SMART
low complexity region 575 588 N/A INTRINSIC
ZnF_C2H2 593 615 3.78e-1 SMART
ZnF_C2H2 621 643 2.27e-4 SMART
ZnF_C2H2 649 671 8.02e-5 SMART
ZnF_C2H2 677 699 3.63e-3 SMART
ZnF_C2H2 705 727 3.11e-2 SMART
ZnF_C2H2 733 753 1.81e1 SMART
low complexity region 759 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218743
Predicted Effect probably benign
Transcript: ENSMUST00000219370
Predicted Effect probably damaging
Transcript: ENSMUST00000220032
AA Change: S666P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3558 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the PR/SET family of zinc finger proteins. This protein has been shown to bind DNA in a sequence-specific manner and has been implicated in neural stem cell proliferation and differentiation. Pseudogenes have been identified on chromosomes 14 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for alleles lacking the zinc finger domain or PR/SET domain exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Vmn1r39 C T 6: 66,804,444 V260I probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Prdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Prdm4 APN 10 85893236 missense probably benign 0.08
IGL02514:Prdm4 APN 10 85907917 missense probably damaging 0.99
IGL02576:Prdm4 APN 10 85900937 missense possibly damaging 0.86
IGL02674:Prdm4 APN 10 85893399 missense probably damaging 0.99
IGL03002:Prdm4 APN 10 85893152 missense probably benign 0.08
IGL03153:Prdm4 APN 10 85907996 missense probably benign
IGL03278:Prdm4 APN 10 85907758 missense probably damaging 0.99
IGL03338:Prdm4 APN 10 85907821 missense possibly damaging 0.90
R0020:Prdm4 UTSW 10 85907623 missense probably benign
R0133:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R0366:Prdm4 UTSW 10 85908004 missense probably damaging 1.00
R0633:Prdm4 UTSW 10 85907903 missense probably damaging 1.00
R1460:Prdm4 UTSW 10 85907822 missense probably benign 0.28
R1477:Prdm4 UTSW 10 85904265 missense probably benign 0.00
R1680:Prdm4 UTSW 10 85899223 missense possibly damaging 0.96
R1772:Prdm4 UTSW 10 85893392 missense probably damaging 0.99
R1983:Prdm4 UTSW 10 85907953 missense probably damaging 1.00
R2136:Prdm4 UTSW 10 85893351 nonsense probably null
R3426:Prdm4 UTSW 10 85910289 missense probably damaging 1.00
R3723:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R4490:Prdm4 UTSW 10 85900899 missense probably damaging 1.00
R4750:Prdm4 UTSW 10 85899221 missense probably damaging 1.00
R5561:Prdm4 UTSW 10 85893123 makesense probably null
R5601:Prdm4 UTSW 10 85893123 makesense probably null
R5602:Prdm4 UTSW 10 85893123 makesense probably null
R5604:Prdm4 UTSW 10 85893123 makesense probably null
R5972:Prdm4 UTSW 10 85907501 missense probably damaging 1.00
R6272:Prdm4 UTSW 10 85907830 missense possibly damaging 0.82
R6300:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R6457:Prdm4 UTSW 10 85908032 missense probably damaging 1.00
R6605:Prdm4 UTSW 10 85904138 missense probably benign 0.00
R6642:Prdm4 UTSW 10 85907818 missense probably benign 0.00
R7663:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCTGGACCCTGGCCTGTAAG -3'
(R):5'- ACTTGGCTCATAGGTGCTGGAATTG -3'

Sequencing Primer
(F):5'- CCTGGCCTGTAAGGGAGAAG -3'
(R):5'- CATAGGTGCTGGAATTGAATCCC -3'
Posted On2014-01-05