Incidental Mutation 'R1134:Erich2'
ID94798
Institutional Source Beutler Lab
Gene Symbol Erich2
Ensembl Gene ENSMUSG00000075302
Gene Nameglutamate rich 2
Synonyms
MMRRC Submission 039207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1134 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70508819-70540884 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 70536191 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 370 (L370*)
Ref Sequence ENSEMBL: ENSMUSP00000122481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100041] [ENSMUST00000134607]
Predicted Effect probably null
Transcript: ENSMUST00000100041
AA Change: L396*
SMART Domains Protein: ENSMUSP00000097619
Gene: ENSMUSG00000075302
AA Change: L396*

DomainStartEndE-ValueType
low complexity region 63 90 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
low complexity region 268 279 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
low complexity region 428 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134607
AA Change: L370*
SMART Domains Protein: ENSMUSP00000122481
Gene: ENSMUSG00000075302
AA Change: L370*

DomainStartEndE-ValueType
low complexity region 63 90 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
low complexity region 242 253 N/A INTRINSIC
low complexity region 321 339 N/A INTRINSIC
low complexity region 402 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151851
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl6 C A 16: 23,968,365 R595L probably benign Het
Cd40 T A 2: 165,070,818 C230S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dusp6 T C 10: 99,264,954 F271L probably damaging Het
Endou A G 15: 97,713,866 V339A probably damaging Het
Fabp12 T C 3: 10,247,671 D97G probably benign Het
Gk5 A G 9: 96,133,407 N92S probably benign Het
Klhl28 A G 12: 64,951,617 S368P probably benign Het
Lhfpl2 C T 13: 94,174,252 S10L probably damaging Het
Morc3 T C 16: 93,870,669 V645A probably benign Het
Ms4a4d C T 19: 11,557,934 L199F possibly damaging Het
Olfr1053 T C 2: 86,315,181 Y35C probably damaging Het
Olfr1341 A G 4: 118,710,279 S291G probably damaging Het
Otog A G 7: 46,298,514 E2313G probably damaging Het
Parp14 A G 16: 35,834,902 V1733A probably damaging Het
Plcl2 G A 17: 50,608,110 V716I probably benign Het
Plekhg2 G T 7: 28,362,001 S816R probably damaging Het
Rev1 G A 1: 38,057,687 S810L probably benign Het
Tbx15 G T 3: 99,316,323 V276L probably damaging Het
Tdpoz4 A T 3: 93,797,218 D274V probably benign Het
Tmem225 T C 9: 40,149,847 L150P possibly damaging Het
Tmem246 T C 4: 49,586,832 Q112R probably benign Het
Trpa1 A T 1: 14,881,748 I909N possibly damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps33a A G 5: 123,570,912 I80T probably damaging Het
Zcchc8 C G 5: 123,717,027 G40R probably damaging Het
Other mutations in Erich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02596:Erich2 APN 2 70512803 intron probably benign
IGL02945:Erich2 APN 2 70534394 missense probably damaging 0.99
IGL03227:Erich2 APN 2 70512770 intron probably benign
IGL03055:Erich2 UTSW 2 70509185 missense possibly damaging 0.83
R0503:Erich2 UTSW 2 70509699 missense probably damaging 0.96
R0503:Erich2 UTSW 2 70540775 missense unknown
R1496:Erich2 UTSW 2 70512773 intron probably benign
R3689:Erich2 UTSW 2 70540753 missense unknown
R4027:Erich2 UTSW 2 70512790 intron probably benign
R4833:Erich2 UTSW 2 70534292 missense possibly damaging 0.92
R6284:Erich2 UTSW 2 70539684 missense probably damaging 1.00
R6884:Erich2 UTSW 2 70509161 missense possibly damaging 0.94
R7485:Erich2 UTSW 2 70531765 missense probably damaging 1.00
R7497:Erich2 UTSW 2 70534322 missense probably damaging 1.00
Z1176:Erich2 UTSW 2 70509114 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGTTAAAAGCAGAATAGCTGCTGGATCA -3'
(R):5'- GGACAGCGATCAGTCTGTCTACATCAA -3'

Sequencing Primer
(F):5'- caagaggcagaggcaagg -3'
(R):5'- TACACACAGAGGTGCTCTTG -3'
Posted On2014-01-05