Incidental Mutation 'R1134:Tdpoz4'
ID94808
Institutional Source Beutler Lab
Gene Symbol Tdpoz4
Ensembl Gene ENSMUSG00000060256
Gene NameTD and POZ domain containing 4
Synonyms
MMRRC Submission 039207-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R1134 (G1)
Quality Score149
Status Not validated
Chromosome3
Chromosomal Location93796398-93797510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93797218 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 274 (D274V)
Ref Sequence ENSEMBL: ENSMUSP00000075338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075953]
Predicted Effect probably benign
Transcript: ENSMUST00000075953
AA Change: D274V

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075338
Gene: ENSMUSG00000060256
AA Change: D274V

DomainStartEndE-ValueType
MATH 24 130 4.81e-2 SMART
BTB 188 287 2.9e-26 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl6 C A 16: 23,968,365 R595L probably benign Het
Cd40 T A 2: 165,070,818 C230S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dusp6 T C 10: 99,264,954 F271L probably damaging Het
Endou A G 15: 97,713,866 V339A probably damaging Het
Erich2 T A 2: 70,536,191 L370* probably null Het
Fabp12 T C 3: 10,247,671 D97G probably benign Het
Gk5 A G 9: 96,133,407 N92S probably benign Het
Klhl28 A G 12: 64,951,617 S368P probably benign Het
Lhfpl2 C T 13: 94,174,252 S10L probably damaging Het
Morc3 T C 16: 93,870,669 V645A probably benign Het
Ms4a4d C T 19: 11,557,934 L199F possibly damaging Het
Olfr1053 T C 2: 86,315,181 Y35C probably damaging Het
Olfr1341 A G 4: 118,710,279 S291G probably damaging Het
Otog A G 7: 46,298,514 E2313G probably damaging Het
Parp14 A G 16: 35,834,902 V1733A probably damaging Het
Plcl2 G A 17: 50,608,110 V716I probably benign Het
Plekhg2 G T 7: 28,362,001 S816R probably damaging Het
Rev1 G A 1: 38,057,687 S810L probably benign Het
Tbx15 G T 3: 99,316,323 V276L probably damaging Het
Tmem225 T C 9: 40,149,847 L150P possibly damaging Het
Tmem246 T C 4: 49,586,832 Q112R probably benign Het
Trpa1 A T 1: 14,881,748 I909N possibly damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps33a A G 5: 123,570,912 I80T probably damaging Het
Zcchc8 C G 5: 123,717,027 G40R probably damaging Het
Other mutations in Tdpoz4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Tdpoz4 APN 3 93797073 missense probably benign 0.22
IGL01731:Tdpoz4 APN 3 93796882 missense possibly damaging 0.62
IGL01934:Tdpoz4 APN 3 93797472 missense probably damaging 1.00
IGL03269:Tdpoz4 APN 3 93796837 missense probably damaging 1.00
FR4340:Tdpoz4 UTSW 3 93796880 frame shift probably null
FR4342:Tdpoz4 UTSW 3 93796880 frame shift probably null
R0387:Tdpoz4 UTSW 3 93796700 missense probably benign 0.26
R1299:Tdpoz4 UTSW 3 93796462 missense probably benign 0.26
R1574:Tdpoz4 UTSW 3 93796528 missense probably benign 0.16
R1574:Tdpoz4 UTSW 3 93796528 missense probably benign 0.16
R2113:Tdpoz4 UTSW 3 93797044 missense probably damaging 1.00
R4601:Tdpoz4 UTSW 3 93797032 missense probably damaging 1.00
R4738:Tdpoz4 UTSW 3 93797089 missense probably damaging 1.00
R4948:Tdpoz4 UTSW 3 93797011 missense probably damaging 1.00
R5495:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5519:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5550:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5595:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5596:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5615:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R7198:Tdpoz4 UTSW 3 93797355 missense probably benign 0.16
R7290:Tdpoz4 UTSW 3 93796848 missense not run
R7677:Tdpoz4 UTSW 3 93797508 makesense probably null
X0066:Tdpoz4 UTSW 3 93796968 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATTCAGGGCTCACAAGGCCATC -3'
(R):5'- AGAGAGTGAAATGCTTCAGCCACC -3'

Sequencing Primer
(F):5'- CCAGTTTTCAGAGCCATGTTTG -3'
(R):5'- GGATGTGACTCCACCATTGAC -3'
Posted On2014-01-05