Mutagenetix > Incidental Mutation

Incidental Mutation 'R1134:Tbx15'

94810

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

039207-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R1134 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 99316323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 276 (V276L)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: V276L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: V276L

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150756

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.9%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl6	C	A	16: 23,968,365	R595L	probably benign	Het
Cd40	T	A	2: 165,070,818	C230S	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Dusp6	T	C	10: 99,264,954	F271L	probably damaging	Het
Endou	A	G	15: 97,713,866	V339A	probably damaging	Het
Erich2	T	A	2: 70,536,191	L370*	probably null	Het
Fabp12	T	C	3: 10,247,671	D97G	probably benign	Het
Gk5	A	G	9: 96,133,407	N92S	probably benign	Het
Klhl28	A	G	12: 64,951,617	S368P	probably benign	Het
Lhfpl2	C	T	13: 94,174,252	S10L	probably damaging	Het
Morc3	T	C	16: 93,870,669	V645A	probably benign	Het
Ms4a4d	C	T	19: 11,557,934	L199F	possibly damaging	Het
Olfr1053	T	C	2: 86,315,181	Y35C	probably damaging	Het
Olfr1341	A	G	4: 118,710,279	S291G	probably damaging	Het
Otog	A	G	7: 46,298,514	E2313G	probably damaging	Het
Parp14	A	G	16: 35,834,902	V1733A	probably damaging	Het
Plcl2	G	A	17: 50,608,110	V716I	probably benign	Het
Plekhg2	G	T	7: 28,362,001	S816R	probably damaging	Het
Rev1	G	A	1: 38,057,687	S810L	probably benign	Het
Tdpoz4	A	T	3: 93,797,218	D274V	probably benign	Het
Tmem225	T	C	9: 40,149,847	L150P	possibly damaging	Het
Tmem246	T	C	4: 49,586,832	Q112R	probably benign	Het
Trpa1	A	T	1: 14,881,748	I909N	possibly damaging	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Vps33a	A	G	5: 123,570,912	I80T	probably damaging	Het
Zcchc8	C	G	5: 123,717,027	G40R	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCATGCCCAGCCTAAACTTTCC -3'
(R):5'- ACTGTCATCACTGTTTCATGTGTGCTAT -3'

Sequencing Primer
(F):5'- CTAAACTTTCCTCTTTGCATTTCAG -3'
(R):5'- gtttttgttgttgttgttgttgttg -3'

Posted On

2014-01-05