Incidental Mutation 'R1134:Tbx15'
ID 94810
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 039207-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R1134 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 99223639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 276 (V276L)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect probably damaging
Transcript: ENSMUST00000029462
AA Change: V276L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: V276L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150756
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl6 C A 16: 23,787,115 (GRCm39) R595L probably benign Het
Cd40 T A 2: 164,912,738 (GRCm39) C230S probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Dusp6 T C 10: 99,100,816 (GRCm39) F271L probably damaging Het
Endou A G 15: 97,611,747 (GRCm39) V339A probably damaging Het
Erich2 T A 2: 70,366,535 (GRCm39) L370* probably null Het
Fabp12 T C 3: 10,312,731 (GRCm39) D97G probably benign Het
Gk5 A G 9: 96,015,460 (GRCm39) N92S probably benign Het
Klhl28 A G 12: 64,998,391 (GRCm39) S368P probably benign Het
Lhfpl2 C T 13: 94,310,760 (GRCm39) S10L probably damaging Het
Morc3 T C 16: 93,667,557 (GRCm39) V645A probably benign Het
Ms4a4d C T 19: 11,535,298 (GRCm39) L199F possibly damaging Het
Or13p3 A G 4: 118,567,476 (GRCm39) S291G probably damaging Het
Or8k21 T C 2: 86,145,525 (GRCm39) Y35C probably damaging Het
Otog A G 7: 45,947,938 (GRCm39) E2313G probably damaging Het
Parp14 A G 16: 35,655,272 (GRCm39) V1733A probably damaging Het
Pgap4 T C 4: 49,586,832 (GRCm39) Q112R probably benign Het
Plcl2 G A 17: 50,915,138 (GRCm39) V716I probably benign Het
Plekhg2 G T 7: 28,061,426 (GRCm39) S816R probably damaging Het
Rev1 G A 1: 38,096,768 (GRCm39) S810L probably benign Het
Tdpoz4 A T 3: 93,704,525 (GRCm39) D274V probably benign Het
Tmem225 T C 9: 40,061,143 (GRCm39) L150P possibly damaging Het
Trpa1 A T 1: 14,951,972 (GRCm39) I909N possibly damaging Het
Ugt2b38 T G 5: 87,560,232 (GRCm39) N361H probably damaging Het
Vps33a A G 5: 123,708,975 (GRCm39) I80T probably damaging Het
Zcchc8 C G 5: 123,855,090 (GRCm39) G40R probably damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATGCCCAGCCTAAACTTTCC -3'
(R):5'- ACTGTCATCACTGTTTCATGTGTGCTAT -3'

Sequencing Primer
(F):5'- CTAAACTTTCCTCTTTGCATTTCAG -3'
(R):5'- gtttttgttgttgttgttgttgttg -3'
Posted On 2014-01-05