Incidental Mutation 'R1134:Tmem246'
ID94812
Institutional Source Beutler Lab
Gene Symbol Tmem246
Ensembl Gene ENSMUSG00000039611
Gene Nametransmembrane protein 246
Synonyms
MMRRC Submission 039207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1134 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49584506-49597876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49586832 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 112 (Q112R)
Ref Sequence ENSEMBL: ENSMUSP00000115100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042750] [ENSMUST00000150664] [ENSMUST00000151542]
Predicted Effect probably benign
Transcript: ENSMUST00000042750
AA Change: Q112R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040885
Gene: ENSMUSG00000039611
AA Change: Q112R

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 262 280 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150664
AA Change: Q112R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115100
Gene: ENSMUSG00000039611
AA Change: Q112R

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151542
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl6 C A 16: 23,968,365 R595L probably benign Het
Cd40 T A 2: 165,070,818 C230S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dusp6 T C 10: 99,264,954 F271L probably damaging Het
Endou A G 15: 97,713,866 V339A probably damaging Het
Erich2 T A 2: 70,536,191 L370* probably null Het
Fabp12 T C 3: 10,247,671 D97G probably benign Het
Gk5 A G 9: 96,133,407 N92S probably benign Het
Klhl28 A G 12: 64,951,617 S368P probably benign Het
Lhfpl2 C T 13: 94,174,252 S10L probably damaging Het
Morc3 T C 16: 93,870,669 V645A probably benign Het
Ms4a4d C T 19: 11,557,934 L199F possibly damaging Het
Olfr1053 T C 2: 86,315,181 Y35C probably damaging Het
Olfr1341 A G 4: 118,710,279 S291G probably damaging Het
Otog A G 7: 46,298,514 E2313G probably damaging Het
Parp14 A G 16: 35,834,902 V1733A probably damaging Het
Plcl2 G A 17: 50,608,110 V716I probably benign Het
Plekhg2 G T 7: 28,362,001 S816R probably damaging Het
Rev1 G A 1: 38,057,687 S810L probably benign Het
Tbx15 G T 3: 99,316,323 V276L probably damaging Het
Tdpoz4 A T 3: 93,797,218 D274V probably benign Het
Tmem225 T C 9: 40,149,847 L150P possibly damaging Het
Trpa1 A T 1: 14,881,748 I909N possibly damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps33a A G 5: 123,570,912 I80T probably damaging Het
Zcchc8 C G 5: 123,717,027 G40R probably damaging Het
Other mutations in Tmem246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Tmem246 APN 4 49586860 missense possibly damaging 0.92
IGL02210:Tmem246 APN 4 49586686 missense probably benign
IGL03239:Tmem246 APN 4 49586034 missense probably damaging 0.99
R0344:Tmem246 UTSW 4 49586566 missense probably benign
R1392:Tmem246 UTSW 4 49586919 missense probably damaging 1.00
R1392:Tmem246 UTSW 4 49586919 missense probably damaging 1.00
R2247:Tmem246 UTSW 4 49586209 missense probably benign 0.05
R2288:Tmem246 UTSW 4 49586445 missense probably damaging 1.00
R4630:Tmem246 UTSW 4 49586254 missense probably benign 0.40
R5530:Tmem246 UTSW 4 49586226 missense probably benign 0.04
R5939:Tmem246 UTSW 4 49586412 missense probably damaging 0.98
R5955:Tmem246 UTSW 4 49586613 missense probably damaging 1.00
R7009:Tmem246 UTSW 4 49586325 missense probably benign
R7837:Tmem246 UTSW 4 49586262 missense probably damaging 0.96
R7920:Tmem246 UTSW 4 49586262 missense probably damaging 0.96
Z1088:Tmem246 UTSW 4 49587135 missense probably damaging 0.97
Z1177:Tmem246 UTSW 4 49586872 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGCAGCGATGACTCCAGGCAATAC -3'
(R):5'- GCATCTAAACCAGATGAGCCAGGAC -3'

Sequencing Primer
(F):5'- AGGGTCATCACCGTAATCGTC -3'
(R):5'- ATGAGCCAGGACTTCCTGC -3'
Posted On2014-01-05