Incidental Mutation 'R1134:Vps33a'
ID94821
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene NameVPS33A CORVET/HOPS core subunit
Synonyms3830421M04Rik, bf
MMRRC Submission 039207-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1134 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123528659-123573038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123570912 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 80 (I80T)
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
Predicted Effect probably damaging
Transcript: ENSMUST00000031388
AA Change: I80T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: I80T

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197467
AA Change: I79T

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198900
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl6 C A 16: 23,968,365 R595L probably benign Het
Cd40 T A 2: 165,070,818 C230S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dusp6 T C 10: 99,264,954 F271L probably damaging Het
Endou A G 15: 97,713,866 V339A probably damaging Het
Erich2 T A 2: 70,536,191 L370* probably null Het
Fabp12 T C 3: 10,247,671 D97G probably benign Het
Gk5 A G 9: 96,133,407 N92S probably benign Het
Klhl28 A G 12: 64,951,617 S368P probably benign Het
Lhfpl2 C T 13: 94,174,252 S10L probably damaging Het
Morc3 T C 16: 93,870,669 V645A probably benign Het
Ms4a4d C T 19: 11,557,934 L199F possibly damaging Het
Olfr1053 T C 2: 86,315,181 Y35C probably damaging Het
Olfr1341 A G 4: 118,710,279 S291G probably damaging Het
Otog A G 7: 46,298,514 E2313G probably damaging Het
Parp14 A G 16: 35,834,902 V1733A probably damaging Het
Plcl2 G A 17: 50,608,110 V716I probably benign Het
Plekhg2 G T 7: 28,362,001 S816R probably damaging Het
Rev1 G A 1: 38,057,687 S810L probably benign Het
Tbx15 G T 3: 99,316,323 V276L probably damaging Het
Tdpoz4 A T 3: 93,797,218 D274V probably benign Het
Tmem225 T C 9: 40,149,847 L150P possibly damaging Het
Tmem246 T C 4: 49,586,832 Q112R probably benign Het
Trpa1 A T 1: 14,881,748 I909N possibly damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Zcchc8 C G 5: 123,717,027 G40R probably damaging Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123572943 missense probably benign 0.00
IGL01459:Vps33a APN 5 123535308 missense probably benign 0.08
IGL02473:Vps33a APN 5 123569571 missense probably damaging 1.00
IGL02899:Vps33a APN 5 123531176 missense probably damaging 1.00
R0498:Vps33a UTSW 5 123570961 missense probably benign 0.40
R1928:Vps33a UTSW 5 123558621 missense probably benign 0.02
R2012:Vps33a UTSW 5 123531181 splice site probably null
R2926:Vps33a UTSW 5 123569571 missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123535211 splice site probably null
R3872:Vps33a UTSW 5 123531192 missense probably benign 0.16
R4437:Vps33a UTSW 5 123531884 missense probably benign
R5153:Vps33a UTSW 5 123558628 missense probably damaging 1.00
R5396:Vps33a UTSW 5 123558630 missense probably damaging 0.98
R5686:Vps33a UTSW 5 123547001 critical splice donor site probably null
R5714:Vps33a UTSW 5 123569500 missense probably benign
R5814:Vps33a UTSW 5 123565056 missense probably damaging 1.00
R6845:Vps33a UTSW 5 123535272 missense probably benign 0.02
R7183:Vps33a UTSW 5 123535215 missense probably null 0.83
R7359:Vps33a UTSW 5 123558633 missense probably benign 0.00
R7593:Vps33a UTSW 5 123536556 missense probably benign 0.00
R7855:Vps33a UTSW 5 123570979 missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123535249 missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123558675 missense possibly damaging 0.76
R8139:Vps33a UTSW 5 123533952 missense probably benign 0.04
R8275:Vps33a UTSW 5 123569459 missense probably damaging 0.99
R8434:Vps33a UTSW 5 123533881 missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123571475 critical splice donor site probably null
R8879:Vps33a UTSW 5 123533899 missense probably damaging 1.00
R8880:Vps33a UTSW 5 123569443 missense probably damaging 0.98
X0026:Vps33a UTSW 5 123547097 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGTCCCACTCTTCCAAATGATGGC -3'
(R):5'- GCACAAGCACTGTTTTGTGTGACTG -3'

Sequencing Primer
(F):5'- gcctacgccaaacctaatgac -3'
(R):5'- GATGCAGAAACAACGGCTTTATC -3'
Posted On2014-01-05