Incidental Mutation 'R1134:Zcchc8'
ID 94823
Institutional Source Beutler Lab
Gene Symbol Zcchc8
Ensembl Gene ENSMUSG00000029427
Gene Name zinc finger, CCHC domain containing 8
Synonyms 5730565F05Rik
MMRRC Submission 039207-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.328) question?
Stock # R1134 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 123836365-123859107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 123855090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 40 (G40R)
Ref Sequence ENSEMBL: ENSMUSP00000142383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031376] [ENSMUST00000196282] [ENSMUST00000200503]
AlphaFold Q9CYA6
Predicted Effect probably damaging
Transcript: ENSMUST00000031376
AA Change: G95R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031376
Gene: ENSMUSG00000029427
AA Change: G95R

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196001
Predicted Effect probably damaging
Transcript: ENSMUST00000196282
AA Change: G95R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142363
Gene: ENSMUSG00000029427
AA Change: G95R

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000196333
AA Change: G59R
Predicted Effect unknown
Transcript: ENSMUST00000198826
AA Change: G19R
Predicted Effect probably benign
Transcript: ENSMUST00000200161
Predicted Effect probably damaging
Transcript: ENSMUST00000200503
AA Change: G40R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl6 C A 16: 23,787,115 (GRCm39) R595L probably benign Het
Cd40 T A 2: 164,912,738 (GRCm39) C230S probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Dusp6 T C 10: 99,100,816 (GRCm39) F271L probably damaging Het
Endou A G 15: 97,611,747 (GRCm39) V339A probably damaging Het
Erich2 T A 2: 70,366,535 (GRCm39) L370* probably null Het
Fabp12 T C 3: 10,312,731 (GRCm39) D97G probably benign Het
Gk5 A G 9: 96,015,460 (GRCm39) N92S probably benign Het
Klhl28 A G 12: 64,998,391 (GRCm39) S368P probably benign Het
Lhfpl2 C T 13: 94,310,760 (GRCm39) S10L probably damaging Het
Morc3 T C 16: 93,667,557 (GRCm39) V645A probably benign Het
Ms4a4d C T 19: 11,535,298 (GRCm39) L199F possibly damaging Het
Or13p3 A G 4: 118,567,476 (GRCm39) S291G probably damaging Het
Or8k21 T C 2: 86,145,525 (GRCm39) Y35C probably damaging Het
Otog A G 7: 45,947,938 (GRCm39) E2313G probably damaging Het
Parp14 A G 16: 35,655,272 (GRCm39) V1733A probably damaging Het
Pgap4 T C 4: 49,586,832 (GRCm39) Q112R probably benign Het
Plcl2 G A 17: 50,915,138 (GRCm39) V716I probably benign Het
Plekhg2 G T 7: 28,061,426 (GRCm39) S816R probably damaging Het
Rev1 G A 1: 38,096,768 (GRCm39) S810L probably benign Het
Tbx15 G T 3: 99,223,639 (GRCm39) V276L probably damaging Het
Tdpoz4 A T 3: 93,704,525 (GRCm39) D274V probably benign Het
Tmem225 T C 9: 40,061,143 (GRCm39) L150P possibly damaging Het
Trpa1 A T 1: 14,951,972 (GRCm39) I909N possibly damaging Het
Ugt2b38 T G 5: 87,560,232 (GRCm39) N361H probably damaging Het
Vps33a A G 5: 123,708,975 (GRCm39) I80T probably damaging Het
Other mutations in Zcchc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Zcchc8 APN 5 123,842,632 (GRCm39) missense probably benign 0.43
IGL01536:Zcchc8 APN 5 123,858,782 (GRCm39) critical splice donor site probably null
IGL02083:Zcchc8 APN 5 123,838,981 (GRCm39) missense probably damaging 1.00
IGL02838:Zcchc8 APN 5 123,857,546 (GRCm39) splice site probably benign
3-1:Zcchc8 UTSW 5 123,847,544 (GRCm39) missense probably damaging 1.00
PIT4515001:Zcchc8 UTSW 5 123,838,995 (GRCm39) missense probably benign 0.23
R0127:Zcchc8 UTSW 5 123,845,400 (GRCm39) missense probably damaging 1.00
R1604:Zcchc8 UTSW 5 123,838,721 (GRCm39) missense probably benign 0.00
R1744:Zcchc8 UTSW 5 123,838,436 (GRCm39) nonsense probably null
R2216:Zcchc8 UTSW 5 123,845,466 (GRCm39) missense probably damaging 1.00
R2303:Zcchc8 UTSW 5 123,838,660 (GRCm39) missense probably benign 0.00
R2877:Zcchc8 UTSW 5 123,838,766 (GRCm39) missense probably benign 0.05
R2964:Zcchc8 UTSW 5 123,858,930 (GRCm39) missense probably benign 0.00
R2966:Zcchc8 UTSW 5 123,858,930 (GRCm39) missense probably benign 0.00
R6831:Zcchc8 UTSW 5 123,838,972 (GRCm39) missense probably damaging 1.00
R7908:Zcchc8 UTSW 5 123,858,783 (GRCm39) critical splice donor site probably benign
R8738:Zcchc8 UTSW 5 123,841,070 (GRCm39) missense probably damaging 0.99
R8791:Zcchc8 UTSW 5 123,845,362 (GRCm39) missense probably benign 0.06
R9487:Zcchc8 UTSW 5 123,847,300 (GRCm39) missense probably damaging 0.99
R9495:Zcchc8 UTSW 5 123,838,633 (GRCm39) missense probably benign 0.00
R9508:Zcchc8 UTSW 5 123,842,584 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTCAAACCATGCTCTCTCATACTTGAA -3'
(R):5'- GCATCTCAGCCCTCTTGGGCTTATT -3'

Sequencing Primer
(F):5'- tgggtaggggagcaggg -3'
(R):5'- ggggaggcagaggtagaag -3'
Posted On 2014-01-05