Incidental Mutation 'R1134:Dusp6'
ID 94842
Institutional Source Beutler Lab
Gene Symbol Dusp6
Ensembl Gene ENSMUSG00000019960
Gene Name dual specificity phosphatase 6
Synonyms 1300019I03Rik, MKP-3, PYST1, MKP3
MMRRC Submission 039207-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R1134 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 99099093-99103351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99100816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 271 (F271L)
Ref Sequence ENSEMBL: ENSMUSP00000020118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020118] [ENSMUST00000220291]
AlphaFold Q9DBB1
Predicted Effect probably damaging
Transcript: ENSMUST00000020118
AA Change: F271L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020118
Gene: ENSMUSG00000019960
AA Change: F271L

DomainStartEndE-ValueType
RHOD 20 145 3.06e-13 SMART
low complexity region 151 187 N/A INTRINSIC
DSPc 206 346 5.51e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220218
Predicted Effect probably benign
Transcript: ENSMUST00000220291
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl6 C A 16: 23,787,115 (GRCm39) R595L probably benign Het
Cd40 T A 2: 164,912,738 (GRCm39) C230S probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Endou A G 15: 97,611,747 (GRCm39) V339A probably damaging Het
Erich2 T A 2: 70,366,535 (GRCm39) L370* probably null Het
Fabp12 T C 3: 10,312,731 (GRCm39) D97G probably benign Het
Gk5 A G 9: 96,015,460 (GRCm39) N92S probably benign Het
Klhl28 A G 12: 64,998,391 (GRCm39) S368P probably benign Het
Lhfpl2 C T 13: 94,310,760 (GRCm39) S10L probably damaging Het
Morc3 T C 16: 93,667,557 (GRCm39) V645A probably benign Het
Ms4a4d C T 19: 11,535,298 (GRCm39) L199F possibly damaging Het
Or13p3 A G 4: 118,567,476 (GRCm39) S291G probably damaging Het
Or8k21 T C 2: 86,145,525 (GRCm39) Y35C probably damaging Het
Otog A G 7: 45,947,938 (GRCm39) E2313G probably damaging Het
Parp14 A G 16: 35,655,272 (GRCm39) V1733A probably damaging Het
Pgap4 T C 4: 49,586,832 (GRCm39) Q112R probably benign Het
Plcl2 G A 17: 50,915,138 (GRCm39) V716I probably benign Het
Plekhg2 G T 7: 28,061,426 (GRCm39) S816R probably damaging Het
Rev1 G A 1: 38,096,768 (GRCm39) S810L probably benign Het
Tbx15 G T 3: 99,223,639 (GRCm39) V276L probably damaging Het
Tdpoz4 A T 3: 93,704,525 (GRCm39) D274V probably benign Het
Tmem225 T C 9: 40,061,143 (GRCm39) L150P possibly damaging Het
Trpa1 A T 1: 14,951,972 (GRCm39) I909N possibly damaging Het
Ugt2b38 T G 5: 87,560,232 (GRCm39) N361H probably damaging Het
Vps33a A G 5: 123,708,975 (GRCm39) I80T probably damaging Het
Zcchc8 C G 5: 123,855,090 (GRCm39) G40R probably damaging Het
Other mutations in Dusp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Dusp6 APN 10 99,101,881 (GRCm39) missense probably damaging 1.00
IGL02687:Dusp6 APN 10 99,102,044 (GRCm39) missense probably damaging 0.97
IGL02996:Dusp6 APN 10 99,100,628 (GRCm39) missense possibly damaging 0.52
IGL03024:Dusp6 APN 10 99,102,156 (GRCm39) missense probably damaging 0.97
R1695:Dusp6 UTSW 10 99,099,555 (GRCm39) start codon destroyed probably null 0.99
R2078:Dusp6 UTSW 10 99,099,686 (GRCm39) missense probably damaging 1.00
R2899:Dusp6 UTSW 10 99,099,707 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R4413:Dusp6 UTSW 10 99,099,786 (GRCm39) missense probably damaging 1.00
R4501:Dusp6 UTSW 10 99,100,457 (GRCm39) missense probably benign 0.41
R5175:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R5381:Dusp6 UTSW 10 99,102,129 (GRCm39) missense possibly damaging 0.46
R5560:Dusp6 UTSW 10 99,102,103 (GRCm39) missense probably damaging 0.97
R5820:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R7359:Dusp6 UTSW 10 99,099,927 (GRCm39) missense probably benign 0.01
R7398:Dusp6 UTSW 10 99,100,740 (GRCm39) missense probably damaging 1.00
R8075:Dusp6 UTSW 10 99,100,810 (GRCm39) missense possibly damaging 0.63
R8491:Dusp6 UTSW 10 99,102,081 (GRCm39) missense possibly damaging 0.66
R8826:Dusp6 UTSW 10 99,099,469 (GRCm39) start gained probably benign
R9084:Dusp6 UTSW 10 99,099,692 (GRCm39) missense probably benign 0.13
R9125:Dusp6 UTSW 10 99,102,074 (GRCm39) nonsense probably null
R9389:Dusp6 UTSW 10 99,099,839 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGAGTCTGACCTTGACCGAGACC -3'
(R):5'- ACATGGCTGATTGGAACAGCCTC -3'

Sequencing Primer
(F):5'- TAGTGCAACGGACTCTGATG -3'
(R):5'- ATCTGCTACGTCAACGGG -3'
Posted On 2014-01-05