Incidental Mutation 'R1025:Baz2b'
ID94850
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
MMRRC Submission 039127-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R1025 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59962482 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 434 (N434S)
Ref Sequence ENSEMBL: ENSMUSP00000108169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
Predicted Effect probably benign
Transcript: ENSMUST00000090925
AA Change: N434S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: N434S

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112550
AA Change: N434S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: N434S

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135722
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A T 17: 48,090,510 K105M probably damaging Het
3110009E18Rik C T 1: 120,171,462 T95I probably damaging Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ap1g1 G A 8: 109,818,939 A75T probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Cers1 A T 8: 70,321,536 I148F probably benign Het
Cpne4 A T 9: 104,993,858 I300F possibly damaging Het
Fsip2 C A 2: 82,989,436 S5171* probably null Het
Gabra2 T C 5: 70,973,595 S297G probably damaging Het
Gm498 A G 7: 143,896,390 Y291C probably damaging Het
Irak3 A T 10: 120,176,346 I171N probably damaging Het
Lama1 A G 17: 67,752,898 I661V probably benign Het
Macf1 T C 4: 123,473,816 D2384G probably damaging Het
Olfr1415 T A 1: 92,491,723 T11S probably benign Het
Olfr307 T C 7: 86,335,905 M164V probably benign Het
Pdcd6ip G A 9: 113,662,286 L630F probably damaging Het
Pkn2 A G 3: 142,821,565 probably null Het
Slc26a4 T G 12: 31,528,737 D639A probably damaging Het
Svep1 C T 4: 58,087,817 C1754Y possibly damaging Het
Trpa1 C A 1: 14,904,183 M258I probably benign Het
Vmn1r17 A T 6: 57,361,255 S42T probably benign Het
Vmn2r57 A G 7: 41,427,804 F313L probably benign Het
Zfp811 A G 17: 32,798,644 Y140H probably benign Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 splice site probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 splice site probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7988:Baz2b UTSW 2 59962141 missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59900768 missense probably damaging 1.00
R8084:Baz2b UTSW 2 59962236 missense probably benign
R8343:Baz2b UTSW 2 59901514 missense probably damaging 1.00
R8348:Baz2b UTSW 2 59911793 missense
R8438:Baz2b UTSW 2 59917484 nonsense probably null
R8448:Baz2b UTSW 2 59911793 missense
R8511:Baz2b UTSW 2 59901814 missense probably benign
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Z1188:Baz2b UTSW 2 59977405 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGTGCTCAGATTGACAGGTGAGG -3'
(R):5'- TGTCTAAGCAAGGTCTGATAGCCCC -3'

Sequencing Primer
(F):5'- GAGAACGGGGTGCTACTTG -3'
(R):5'- GCTGTGTTCTGATACTGACAAAC -3'
Posted On2014-01-05