Incidental Mutation 'R1134:Lhfpl2'
ID94853
Institutional Source Beutler Lab
Gene Symbol Lhfpl2
Ensembl Gene ENSMUSG00000045312
Gene Namelipoma HMGIC fusion partner-like 2
Synonymsvgim
MMRRC Submission 039207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R1134 (G1)
Quality Score201
Status Not validated
Chromosome13
Chromosomal Location94057796-94195409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94174252 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 10 (S10L)
Ref Sequence ENSEMBL: ENSMUSP00000152241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054274] [ENSMUST00000118195] [ENSMUST00000120051] [ENSMUST00000121618] [ENSMUST00000156071] [ENSMUST00000221096] [ENSMUST00000223423]
Predicted Effect probably damaging
Transcript: ENSMUST00000054274
AA Change: S10L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062239
Gene: ENSMUSG00000045312
AA Change: S10L

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.3e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118195
AA Change: S10L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112655
Gene: ENSMUSG00000045312
AA Change: S10L

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.4e-59 PFAM
Pfam:Claudin_2 16 197 3.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120051
AA Change: S10L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000121618
AA Change: S10L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113468
Gene: ENSMUSG00000045312
AA Change: S10L

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.4e-59 PFAM
Pfam:Claudin_2 16 197 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131595
Predicted Effect probably damaging
Transcript: ENSMUST00000156071
AA Change: S10L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117113
Gene: ENSMUSG00000045312
AA Change: S10L

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 139 2.3e-35 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221096
AA Change: S10L
Predicted Effect probably damaging
Transcript: ENSMUST00000223423
AA Change: S10L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females homozygous for a spontaneous point mutation have a completely closed vagina, soft swelling of the perineum and buildup of viscous fluid in the uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl6 C A 16: 23,968,365 R595L probably benign Het
Cd40 T A 2: 165,070,818 C230S probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dusp6 T C 10: 99,264,954 F271L probably damaging Het
Endou A G 15: 97,713,866 V339A probably damaging Het
Erich2 T A 2: 70,536,191 L370* probably null Het
Fabp12 T C 3: 10,247,671 D97G probably benign Het
Gk5 A G 9: 96,133,407 N92S probably benign Het
Klhl28 A G 12: 64,951,617 S368P probably benign Het
Morc3 T C 16: 93,870,669 V645A probably benign Het
Ms4a4d C T 19: 11,557,934 L199F possibly damaging Het
Olfr1053 T C 2: 86,315,181 Y35C probably damaging Het
Olfr1341 A G 4: 118,710,279 S291G probably damaging Het
Otog A G 7: 46,298,514 E2313G probably damaging Het
Parp14 A G 16: 35,834,902 V1733A probably damaging Het
Plcl2 G A 17: 50,608,110 V716I probably benign Het
Plekhg2 G T 7: 28,362,001 S816R probably damaging Het
Rev1 G A 1: 38,057,687 S810L probably benign Het
Tbx15 G T 3: 99,316,323 V276L probably damaging Het
Tdpoz4 A T 3: 93,797,218 D274V probably benign Het
Tmem225 T C 9: 40,149,847 L150P possibly damaging Het
Tmem246 T C 4: 49,586,832 Q112R probably benign Het
Trpa1 A T 1: 14,881,748 I909N possibly damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps33a A G 5: 123,570,912 I80T probably damaging Het
Zcchc8 C G 5: 123,717,027 G40R probably damaging Het
Other mutations in Lhfpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Lhfpl2 APN 13 94191911 missense probably benign 0.00
IGL02576:Lhfpl2 APN 13 94174226 start codon destroyed probably null 1.00
R0278:Lhfpl2 UTSW 13 94174435 missense probably benign 0.00
R0482:Lhfpl2 UTSW 13 94174610 missense probably damaging 1.00
R2130:Lhfpl2 UTSW 13 94192049 missense possibly damaging 0.91
R2302:Lhfpl2 UTSW 13 94174546 missense probably benign 0.00
R2995:Lhfpl2 UTSW 13 94174458 missense probably benign 0.04
R6613:Lhfpl2 UTSW 13 94174495 missense probably damaging 1.00
R6922:Lhfpl2 UTSW 13 94174521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCAGCACTCAGTCTGAATGCC -3'
(R):5'- GCCACTACGCAGAGAATGAAGATCC -3'

Sequencing Primer
(F):5'- TCAGTCTGAATGCCGACAG -3'
(R):5'- AGAGACTTGCTGCATGGC -3'
Posted On2014-01-05