Incidental Mutation 'R1025:Cers1'
ID94892
Institutional Source Beutler Lab
Gene Symbol Cers1
Ensembl Gene ENSMUSG00000087408
Gene Nameceramide synthase 1
SynonymsCerS1, to, Uog-1, Lass1
MMRRC Submission 039127-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R1025 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70315775-70331592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70321536 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 148 (I148F)
Ref Sequence ENSEMBL: ENSMUSP00000120598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140239] [ENSMUST00000165819]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136257
Predicted Effect probably benign
Transcript: ENSMUST00000140239
AA Change: I148F

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408
AA Change: I148F

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165819
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Meta Mutation Damage Score 0.3462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Mice lacking a functional copy of this gene exhibit impaired cerebellar development, locomotion and motor coordination. This protein is transcribed from a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for the spontaneous toppler mutation display reduced body and brain weight, a small cerebellum, progressive tremors, ataxia, impaired balance and seizures, as well as dramatic dendritic changes and severe loss of Purkinje cells, glial changes, and a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A T 17: 48,090,510 K105M probably damaging Het
3110009E18Rik C T 1: 120,171,462 T95I probably damaging Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ap1g1 G A 8: 109,818,939 A75T probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Baz2b T C 2: 59,962,482 N434S probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Cpne4 A T 9: 104,993,858 I300F possibly damaging Het
Fsip2 C A 2: 82,989,436 S5171* probably null Het
Gabra2 T C 5: 70,973,595 S297G probably damaging Het
Gm498 A G 7: 143,896,390 Y291C probably damaging Het
Irak3 A T 10: 120,176,346 I171N probably damaging Het
Lama1 A G 17: 67,752,898 I661V probably benign Het
Macf1 T C 4: 123,473,816 D2384G probably damaging Het
Olfr1415 T A 1: 92,491,723 T11S probably benign Het
Olfr307 T C 7: 86,335,905 M164V probably benign Het
Pdcd6ip G A 9: 113,662,286 L630F probably damaging Het
Pkn2 A G 3: 142,821,565 probably null Het
Slc26a4 T G 12: 31,528,737 D639A probably damaging Het
Svep1 C T 4: 58,087,817 C1754Y possibly damaging Het
Trpa1 C A 1: 14,904,183 M258I probably benign Het
Vmn1r17 A T 6: 57,361,255 S42T probably benign Het
Vmn2r57 A G 7: 41,427,804 F313L probably benign Het
Zfp811 A G 17: 32,798,644 Y140H probably benign Het
Other mutations in Cers1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Cers1 APN 8 70323233 missense probably damaging 1.00
IGL01982:Cers1 APN 8 70323431 missense probably damaging 0.99
IGL02827:Cers1 APN 8 70321527 missense probably damaging 1.00
R1456:Cers1 UTSW 8 70331188 missense probably damaging 1.00
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1764:Cers1 UTSW 8 70321491 splice site probably null
R2397:Cers1 UTSW 8 70321536 missense probably benign 0.44
R3107:Cers1 UTSW 8 70322636 missense probably benign 0.30
R3808:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R3809:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R4789:Cers1 UTSW 8 70323368 missense probably damaging 0.96
R5450:Cers1 UTSW 8 70318297 missense probably damaging 0.99
R5987:Cers1 UTSW 8 70321578 missense possibly damaging 0.78
R6274:Cers1 UTSW 8 70331077 missense probably damaging 1.00
R6535:Cers1 UTSW 8 70330154 missense probably damaging 1.00
R7060:Cers1 UTSW 8 70315905 missense possibly damaging 0.86
R7152:Cers1 UTSW 8 70318251 missense probably damaging 1.00
R8338:Cers1 UTSW 8 70331122 missense possibly damaging 0.92
R8371:Cers1 UTSW 8 70329573 missense probably benign
Z1176:Cers1 UTSW 8 70318318 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTGAGAAGAGAATCCTGACTCCCG -3'
(R):5'- AAAGGGTGTCACCAGGCTTAGTCC -3'

Sequencing Primer
(F):5'- gaatcctgactcccgatgtg -3'
(R):5'- TTAGTCCCGAGGGAGCAG -3'
Posted On2014-01-05