Incidental Mutation 'R1025:Cpne4'
ID94896
Institutional Source Beutler Lab
Gene Symbol Cpne4
Ensembl Gene ENSMUSG00000032564
Gene Namecopine IV
Synonyms
MMRRC Submission 039127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1025 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location104547286-105034544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104993858 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 300 (I300F)
Ref Sequence ENSEMBL: ENSMUSP00000049663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057742] [ENSMUST00000077190] [ENSMUST00000213120] [ENSMUST00000213452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057742
AA Change: I300F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049663
Gene: ENSMUSG00000032564
AA Change: I300F

DomainStartEndE-ValueType
C2 24 130 4.29e-6 SMART
C2 144 261 4.22e-5 SMART
low complexity region 269 279 N/A INTRINSIC
VWA 305 507 2.61e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077190
SMART Domains Protein: ENSMUSP00000076432
Gene: ENSMUSG00000032564

DomainStartEndE-ValueType
C2 24 130 4.29e-6 SMART
C2 144 275 1.94e1 SMART
VWA 223 425 9.73e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157579
Predicted Effect probably benign
Transcript: ENSMUST00000213120
Predicted Effect probably benign
Transcript: ENSMUST00000213452
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the highly conserved copine family. It encodes a calcium-dependent, phospholipid-binding protein, which may be involved in membrane trafficking, mitogenesis and development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A T 17: 48,090,510 K105M probably damaging Het
3110009E18Rik C T 1: 120,171,462 T95I probably damaging Het
Alyref C G 11: 120,595,932 V168L probably damaging Het
Ap1g1 G A 8: 109,818,939 A75T probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Baz2b T C 2: 59,962,482 N434S probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Cers1 A T 8: 70,321,536 I148F probably benign Het
Fsip2 C A 2: 82,989,436 S5171* probably null Het
Gabra2 T C 5: 70,973,595 S297G probably damaging Het
Gm498 A G 7: 143,896,390 Y291C probably damaging Het
Irak3 A T 10: 120,176,346 I171N probably damaging Het
Lama1 A G 17: 67,752,898 I661V probably benign Het
Macf1 T C 4: 123,473,816 D2384G probably damaging Het
Olfr1415 T A 1: 92,491,723 T11S probably benign Het
Olfr307 T C 7: 86,335,905 M164V probably benign Het
Pdcd6ip G A 9: 113,662,286 L630F probably damaging Het
Pkn2 A G 3: 142,821,565 probably null Het
Slc26a4 T G 12: 31,528,737 D639A probably damaging Het
Svep1 C T 4: 58,087,817 C1754Y possibly damaging Het
Trpa1 C A 1: 14,904,183 M258I probably benign Het
Vmn1r17 A T 6: 57,361,255 S42T probably benign Het
Vmn2r57 A G 7: 41,427,804 F313L probably benign Het
Zfp811 A G 17: 32,798,644 Y140H probably benign Het
Other mutations in Cpne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Cpne4 APN 9 104901511 missense probably damaging 1.00
IGL01871:Cpne4 APN 9 104925757 missense possibly damaging 0.93
IGL02097:Cpne4 APN 9 104686502 missense probably damaging 1.00
IGL02698:Cpne4 APN 9 105032785 missense probably damaging 1.00
IGL02933:Cpne4 APN 9 105019767 missense possibly damaging 0.64
R0471:Cpne4 UTSW 9 105022282 splice site probably null
R0528:Cpne4 UTSW 9 104686441 missense probably damaging 0.99
R0698:Cpne4 UTSW 9 104925795 missense probably damaging 1.00
R1054:Cpne4 UTSW 9 105022401 missense probably benign 0.01
R1300:Cpne4 UTSW 9 104993134 missense probably damaging 1.00
R1422:Cpne4 UTSW 9 104900285 missense probably damaging 0.98
R1439:Cpne4 UTSW 9 104989632 missense probably damaging 0.99
R1634:Cpne4 UTSW 9 104989579 missense possibly damaging 0.94
R1777:Cpne4 UTSW 9 104872688 missense probably damaging 1.00
R2992:Cpne4 UTSW 9 105022365 missense probably damaging 1.00
R4094:Cpne4 UTSW 9 104686535 missense probably damaging 1.00
R4729:Cpne4 UTSW 9 104922556 missense probably damaging 0.96
R4943:Cpne4 UTSW 9 105019773 missense probably damaging 1.00
R5119:Cpne4 UTSW 9 104901521 splice site probably null
R5787:Cpne4 UTSW 9 105022401 missense probably benign 0.01
R5839:Cpne4 UTSW 9 104925828 missense probably damaging 1.00
R5876:Cpne4 UTSW 9 104925770 missense probably damaging 0.98
R7386:Cpne4 UTSW 9 104872740 missense possibly damaging 0.82
R7849:Cpne4 UTSW 9 104686519 missense probably damaging 0.99
R7887:Cpne4 UTSW 9 105032791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCTTCTCCAAAGGGCAGATG -3'
(R):5'- GCTGAGGAGCAAGGATCATACTCAC -3'

Sequencing Primer
(F):5'- GCAAGGGGTGAGAATCTGC -3'
(R):5'- ATCATACTCACCAGAAGGAGATG -3'
Posted On2014-01-05