Mutagenetix > Incidental Mutations

Incidental Mutation 'R1025:Cpne4'

94896

Institutional Source

Beutler Lab

Gene Symbol

Cpne4

Ensembl Gene

ENSMUSG00000032564

Gene Name

copine IV

Synonyms

MMRRC Submission

039127-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R1025 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104547286-105034544 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104993858 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 300 (I300F)

Ref Sequence

ENSEMBL: ENSMUSP00000049663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057742] [ENSMUST00000077190] [ENSMUST00000213120] [ENSMUST00000213452]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057742
AA Change: I300F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000049663
Gene: ENSMUSG00000032564
AA Change: I300F

Domain	Start	End	E-Value	Type
C2	24	130	4.29e-6	SMART
C2	144	261	4.22e-5	SMART
low complexity region	269	279	N/A	INTRINSIC
VWA	305	507	2.61e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000077190

SMART Domains

Protein: ENSMUSP00000076432
Gene: ENSMUSG00000032564

Domain	Start	End	E-Value	Type
C2	24	130	4.29e-6	SMART
C2	144	275	1.94e1	SMART
VWA	223	425	9.73e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157579

Predicted Effect

probably benign
Transcript: ENSMUST00000213120

Predicted Effect

probably benign
Transcript: ENSMUST00000213452

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the highly conserved copine family. It encodes a calcium-dependent, phospholipid-binding protein, which may be involved in membrane trafficking, mitogenesis and development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700067P10Rik	A	T	17: 48,090,510	K105M	probably damaging	Het
3110009E18Rik	C	T	1: 120,171,462	T95I	probably damaging	Het
Alyref	C	G	11: 120,595,932	V168L	probably damaging	Het
Ap1g1	G	A	8: 109,818,939	A75T	probably benign	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Baz2b	T	C	2: 59,962,482	N434S	probably benign	Het
Cebpzos	A	G	17: 78,918,388	K11E	probably damaging	Het
Cers1	A	T	8: 70,321,536	I148F	probably benign	Het
Fsip2	C	A	2: 82,989,436	S5171*	probably null	Het
Gabra2	T	C	5: 70,973,595	S297G	probably damaging	Het
Gm498	A	G	7: 143,896,390	Y291C	probably damaging	Het
Irak3	A	T	10: 120,176,346	I171N	probably damaging	Het
Lama1	A	G	17: 67,752,898	I661V	probably benign	Het
Macf1	T	C	4: 123,473,816	D2384G	probably damaging	Het
Olfr1415	T	A	1: 92,491,723	T11S	probably benign	Het
Olfr307	T	C	7: 86,335,905	M164V	probably benign	Het
Pdcd6ip	G	A	9: 113,662,286	L630F	probably damaging	Het
Pkn2	A	G	3: 142,821,565		probably null	Het
Slc26a4	T	G	12: 31,528,737	D639A	probably damaging	Het
Svep1	C	T	4: 58,087,817	C1754Y	possibly damaging	Het
Trpa1	C	A	1: 14,904,183	M258I	probably benign	Het
Vmn1r17	A	T	6: 57,361,255	S42T	probably benign	Het
Vmn2r57	A	G	7: 41,427,804	F313L	probably benign	Het
Zfp811	A	G	17: 32,798,644	Y140H	probably benign	Het

Other mutations in Cpne4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01650:Cpne4	APN	9	104901511	missense	probably damaging	1.00
IGL01871:Cpne4	APN	9	104925757	missense	possibly damaging	0.93
IGL02097:Cpne4	APN	9	104686502	missense	probably damaging	1.00
IGL02698:Cpne4	APN	9	105032785	missense	probably damaging	1.00
IGL02933:Cpne4	APN	9	105019767	missense	possibly damaging	0.64
R0471:Cpne4	UTSW	9	105022282	splice site	probably null
R0528:Cpne4	UTSW	9	104686441	missense	probably damaging	0.99
R0698:Cpne4	UTSW	9	104925795	missense	probably damaging	1.00
R1054:Cpne4	UTSW	9	105022401	missense	probably benign	0.01
R1300:Cpne4	UTSW	9	104993134	missense	probably damaging	1.00
R1422:Cpne4	UTSW	9	104900285	missense	probably damaging	0.98
R1439:Cpne4	UTSW	9	104989632	missense	probably damaging	0.99
R1634:Cpne4	UTSW	9	104989579	missense	possibly damaging	0.94
R1777:Cpne4	UTSW	9	104872688	missense	probably damaging	1.00
R2992:Cpne4	UTSW	9	105022365	missense	probably damaging	1.00
R4094:Cpne4	UTSW	9	104686535	missense	probably damaging	1.00
R4729:Cpne4	UTSW	9	104922556	missense	probably damaging	0.96
R4943:Cpne4	UTSW	9	105019773	missense	probably damaging	1.00
R5119:Cpne4	UTSW	9	104901521	splice site	probably null
R5787:Cpne4	UTSW	9	105022401	missense	probably benign	0.01
R5839:Cpne4	UTSW	9	104925828	missense	probably damaging	1.00
R5876:Cpne4	UTSW	9	104925770	missense	probably damaging	0.98
R7386:Cpne4	UTSW	9	104872740	missense	possibly damaging	0.82
R7849:Cpne4	UTSW	9	104686519	missense	probably damaging	0.99
R7887:Cpne4	UTSW	9	105032791	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGTCTTCTCCAAAGGGCAGATG -3'
(R):5'- GCTGAGGAGCAAGGATCATACTCAC -3'

Sequencing Primer
(F):5'- GCAAGGGGTGAGAATCTGC -3'
(R):5'- ATCATACTCACCAGAAGGAGATG -3'

Posted On

2014-01-05