Incidental Mutation 'R1135:Skint10'
ID94897
Institutional Source Beutler Lab
Gene Symbol Skint10
Ensembl Gene ENSMUSG00000048766
Gene Nameselection and upkeep of intraepithelial T cells 10
SynonymsA030001H23Rik
MMRRC Submission 039208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1135 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location112711147-112774866 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 112711463 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 352 (W352*)
Ref Sequence ENSEMBL: ENSMUSP00000058838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060327]
Predicted Effect probably null
Transcript: ENSMUST00000060327
AA Change: W352*
SMART Domains Protein: ENSMUSP00000058838
Gene: ENSMUSG00000048766
AA Change: W352*

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:4F8T|A 50 149 5e-8 PDB
Blast:IG_like 56 143 3e-11 BLAST
transmembrane domain 162 184 N/A INTRINSIC
transmembrane domain 212 229 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik G T 4: 147,944,658 V362L probably benign Het
Ak5 T A 3: 152,653,662 L166F probably damaging Het
Camk2a T A 18: 60,957,396 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cr2 A T 1: 195,157,190 I643N probably damaging Het
Fibin G A 2: 110,362,222 H192Y probably benign Het
Ints11 T C 4: 155,887,927 probably null Het
Lct A G 1: 128,294,124 probably null Het
Msantd2 A G 9: 37,522,712 I83V probably damaging Het
Myh10 A T 11: 68,807,197 M1622L probably benign Het
Nkx2-4 G T 2: 147,084,408 S178* probably null Het
Nox4 C T 7: 87,323,789 P335S probably damaging Het
Rab3gap2 G A 1: 185,275,943 R1085Q possibly damaging Het
Srsf4 T G 4: 131,900,069 probably benign Het
Sytl1 C T 4: 133,256,970 G274D probably damaging Het
Tbck T A 3: 132,732,191 I459N probably damaging Het
Trhr2 A G 8: 122,358,633 L204P probably damaging Het
Vps13d T C 4: 145,155,589 T1145A probably benign Het
Wnk2 G A 13: 49,076,558 P830L probably damaging Het
Other mutations in Skint10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02660:Skint10 APN 4 112765030 unclassified probably benign
IGL02891:Skint10 APN 4 112728826 missense probably benign 0.03
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0067:Skint10 UTSW 4 112711556 missense probably benign
R0540:Skint10 UTSW 4 112773027 critical splice donor site probably null
R0544:Skint10 UTSW 4 112728811 splice site probably benign
R0711:Skint10 UTSW 4 112715905 splice site probably benign
R1341:Skint10 UTSW 4 112765031 unclassified probably benign
R2845:Skint10 UTSW 4 112715826 missense probably benign 0.00
R3717:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R3718:Skint10 UTSW 4 112746739 missense probably damaging 1.00
R4349:Skint10 UTSW 4 112769771 makesense probably null
R4857:Skint10 UTSW 4 112746633 missense possibly damaging 0.92
R4988:Skint10 UTSW 4 112728872 nonsense probably null
R5010:Skint10 UTSW 4 112727672 missense probably benign 0.14
R5354:Skint10 UTSW 4 112711593 missense possibly damaging 0.57
R5567:Skint10 UTSW 4 112715870 missense probably damaging 0.98
R5716:Skint10 UTSW 4 112711647 missense probably damaging 0.97
R5827:Skint10 UTSW 4 112746775 missense probably benign 0.00
R6705:Skint10 UTSW 4 112773104 intron probably benign
R7220:Skint10 UTSW 4 112728973 missense probably benign 0.00
R7620:Skint10 UTSW 4 112715817 missense possibly damaging 0.78
R7724:Skint10 UTSW 4 112765092 nonsense probably null
R7827:Skint10 UTSW 4 112774806 nonsense probably null
R8007:Skint10 UTSW 4 112711668 missense possibly damaging 0.87
R8056:Skint10 UTSW 4 112715813 missense probably benign 0.02
X0028:Skint10 UTSW 4 112746665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- tgagtcatttctccaacctcTTTCACTG -3'
(R):5'- TGCTGATTGTGGGTAACAAGTTGCTA -3'

Sequencing Primer
(F):5'- tgggagaagatagagagatgaaag -3'
(R):5'- GAGCATGGATCTTTCCAAACATGAC -3'
Posted On2014-01-05