Incidental Mutation 'R1135:Trhr2'
ID94925
Institutional Source Beutler Lab
Gene Symbol Trhr2
Ensembl Gene ENSMUSG00000039079
Gene Namethyrotropin releasing hormone receptor 2
SynonymsTRH-R2
MMRRC Submission 039208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R1135 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122356967-122360746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122358633 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 204 (L204P)
Ref Sequence ENSEMBL: ENSMUSP00000042575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044123] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000044123
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042575
Gene: ENSMUSG00000039079
AA Change: L204P

DomainStartEndE-ValueType
Pfam:7tm_4 29 184 1e-12 PFAM
Pfam:7TM_GPCR_Srv 29 325 2e-7 PFAM
Pfam:7TM_GPCR_Srx 30 165 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 33 323 5.6e-10 PFAM
Pfam:7tm_1 39 308 5.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik G T 4: 147,944,658 V362L probably benign Het
Ak5 T A 3: 152,653,662 L166F probably damaging Het
Camk2a T A 18: 60,957,396 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cr2 A T 1: 195,157,190 I643N probably damaging Het
Fibin G A 2: 110,362,222 H192Y probably benign Het
Ints11 T C 4: 155,887,927 probably null Het
Lct A G 1: 128,294,124 probably null Het
Msantd2 A G 9: 37,522,712 I83V probably damaging Het
Myh10 A T 11: 68,807,197 M1622L probably benign Het
Nkx2-4 G T 2: 147,084,408 S178* probably null Het
Nox4 C T 7: 87,323,789 P335S probably damaging Het
Rab3gap2 G A 1: 185,275,943 R1085Q possibly damaging Het
Skint10 C T 4: 112,711,463 W352* probably null Het
Srsf4 T G 4: 131,900,069 probably benign Het
Sytl1 C T 4: 133,256,970 G274D probably damaging Het
Tbck T A 3: 132,732,191 I459N probably damaging Het
Vps13d T C 4: 145,155,589 T1145A probably benign Het
Wnk2 G A 13: 49,076,558 P830L probably damaging Het
Other mutations in Trhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03070:Trhr2 APN 8 122358603 missense probably benign
IGL03387:Trhr2 APN 8 122358481 intron probably benign
IGL03408:Trhr2 APN 8 122358795 missense probably damaging 1.00
R0546:Trhr2 UTSW 8 122358489 critical splice donor site probably null
R1377:Trhr2 UTSW 8 122360588 missense probably damaging 1.00
R1656:Trhr2 UTSW 8 122357446 missense probably damaging 1.00
R2055:Trhr2 UTSW 8 122358793 missense probably damaging 1.00
R4030:Trhr2 UTSW 8 122360699 start codon destroyed probably null 0.01
R4998:Trhr2 UTSW 8 122358772 missense probably benign 0.04
R5074:Trhr2 UTSW 8 122357371 missense probably benign 0.01
R6175:Trhr2 UTSW 8 122357379 missense probably damaging 0.99
R7048:Trhr2 UTSW 8 122358679 missense probably damaging 1.00
R7168:Trhr2 UTSW 8 122360537 missense probably damaging 1.00
R7185:Trhr2 UTSW 8 122360657 missense probably benign 0.26
R7284:Trhr2 UTSW 8 122360375 missense probably damaging 1.00
R7314:Trhr2 UTSW 8 122358750 missense possibly damaging 0.64
R7644:Trhr2 UTSW 8 122357322 missense possibly damaging 0.93
R7891:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
R7974:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
Z1176:Trhr2 UTSW 8 122358795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAACCTGCTTCCTGGAGGACATTG -3'
(R):5'- CAGCTCAGCCATTATCGCCTAGAC -3'

Sequencing Primer
(F):5'- TTGAGCTCTTGGACCTAGAGCA -3'
(R):5'- TTAGGAGCCAACATGCCTTG -3'
Posted On2014-01-05