Incidental Mutation 'R1136:Hnrnpu'
ID94958
Institutional Source Beutler Lab
Gene Symbol Hnrnpu
Ensembl Gene ENSMUSG00000039630
Gene Nameheterogeneous nuclear ribonucleoprotein U
SynonymsHnrpu, scaffold attachment factor A, Sp120
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1136 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location178321108-178337797 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 178331225 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037748] [ENSMUST00000161769]
Predicted Effect unknown
Transcript: ENSMUST00000037748
AA Change: C570S
SMART Domains Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630
AA Change: C570S

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 2e-30 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150825
Predicted Effect unknown
Transcript: ENSMUST00000161769
AA Change: C570S
SMART Domains Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630
AA Change: C570S

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 6.7e-31 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162916
Predicted Effect probably benign
Transcript: ENSMUST00000188044
Predicted Effect probably benign
Transcript: ENSMUST00000189450
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality, delayed embryonic development, and failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Hnrnpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Hnrnpu APN 1 178330774 unclassified probably benign
R1205:Hnrnpu UTSW 1 178332169 unclassified probably benign
R1317:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1318:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1778:Hnrnpu UTSW 1 178325241 critical splice donor site probably benign
R3160:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3161:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R4408:Hnrnpu UTSW 1 178330803 unclassified probably benign
R4667:Hnrnpu UTSW 1 178332181 unclassified probably benign
R4833:Hnrnpu UTSW 1 178333894 unclassified probably benign
R4906:Hnrnpu UTSW 1 178329373 intron probably benign
R4923:Hnrnpu UTSW 1 178331452 unclassified probably benign
R5000:Hnrnpu UTSW 1 178329376 intron probably benign
R5256:Hnrnpu UTSW 1 178335893 missense unknown
R5307:Hnrnpu UTSW 1 178337312 missense unknown
R5911:Hnrnpu UTSW 1 178330172 unclassified probably benign
R6931:Hnrnpu UTSW 1 178331432 unclassified probably benign
R7061:Hnrnpu UTSW 1 178336126 missense unknown
R7077:Hnrnpu UTSW 1 178332191 missense unknown
R7391:Hnrnpu UTSW 1 178337078 missense unknown
R7423:Hnrnpu UTSW 1 178329284 intron probably benign
R8037:Hnrnpu UTSW 1 178332352 missense unknown
Z1176:Hnrnpu UTSW 1 178332215 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTATCTGGTCACGGCCTTCATCAC -3'
(R):5'- AACACACTGTTGCAGAGAGCCC -3'

Sequencing Primer
(F):5'- TTTCTAGGTATAAATCCCCAAACCG -3'
(R):5'- AGAGCCCCACAGTGTCTTG -3'
Posted On2014-01-05