Mutagenetix > Incidental Mutations

Incidental Mutation 'R1136:Nmd3'

94966

Institutional Source

Beutler Lab

Gene Symbol

Nmd3

Ensembl Gene

ENSMUSG00000027787

Gene Name

NMD3 ribosome export adaptor

Synonyms

C87860

MMRRC Submission

039209-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R1136 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69721985-69756373 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 69746716 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000029358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029358]

Predicted Effect

probably benign
Transcript: ENSMUST00000029358

SMART Domains

Protein: ENSMUSP00000029358
Gene: ENSMUSG00000027787

Domain	Start	End	E-Value	Type
Pfam:NMD3	17	246	6.6e-82	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150210

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.7%
20x: 90.5%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomal 40S and 60S subunits associate in the nucleolus and are exported to the cytoplasm. The protein encoded by this gene is involved in the passage of the 60S subunit through the nuclear pore complex and into the cytoplasm. Several transcript variants exist for this gene, but the full-length natures of only two have been described to date. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy2	C	T	13: 68,730,317	G401S	probably damaging	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Bmp2	T	C	2: 133,560,927	F133L	probably damaging	Het
C1qtnf3	A	G	15: 10,978,584	E290G	probably damaging	Het
Ccdc180	C	A	4: 45,914,589	D701E	probably benign	Het
Chmp7	C	T	14: 69,719,450	M336I	probably benign	Het
Csmd3	A	T	15: 47,675,817	I1508N	probably damaging	Het
Dgkh	T	C	14: 78,624,889	R80G	probably damaging	Het
Dock1	T	A	7: 134,848,173	V805D	possibly damaging	Het
Eef2	C	CN	10: 81,178,769		probably null	Het
Ercc6l2	T	A	13: 63,869,120	V679D	possibly damaging	Het
Esp6	T	C	17: 40,565,393	Y111H	probably benign	Het
Focad	T	C	4: 88,326,180	F799S	unknown	Het
Foxred1	C	A	9: 35,205,037	M438I	probably benign	Het
Galnt11	T	G	5: 25,258,945	V405G	probably damaging	Het
Gm4847	A	G	1: 166,630,366	Y473H	probably damaging	Het
Gpbp1l1	C	T	4: 116,592,918	T461M	probably damaging	Het
Hnrnpu	A	T	1: 178,331,225		probably benign	Het
Kmt2d	A	T	15: 98,857,765		probably benign	Het
Matr3	A	G	18: 35,572,895	H291R	probably damaging	Het
Mfsd14b	C	T	13: 65,095,692	S46N	probably benign	Het
Mtch1	C	T	17: 29,333,770		probably null	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mylk	T	C	16: 35,000,318	I1880T	probably damaging	Het
N4bp2	T	C	5: 65,808,472	L1288P	probably damaging	Het
Ncf2	A	T	1: 152,830,372	H245L	probably damaging	Het
Npdc1	G	T	2: 25,407,715	A127S	probably benign	Het
Nudt3	C	A	17: 27,623,106	R27L	probably benign	Het
Nwd1	C	T	8: 72,697,769		probably benign	Het
Papd4	C	T	13: 93,175,697		probably null	Het
Pex7	T	A	10: 19,888,688	I170F	probably benign	Het
Phyhipl	A	G	10: 70,569,072	V57A	probably damaging	Het
Pkhd1	G	A	1: 20,522,829	P1687S	possibly damaging	Het
Plekhj1	A	T	10: 80,797,820		probably null	Het
Prss21	T	A	17: 23,872,994	L312H	probably damaging	Het
Samsn1	T	C	16: 75,873,520	I232V	probably null	Het
Sec63	A	T	10: 42,806,546	D411V	probably damaging	Het
Slc44a4	C	T	17: 34,928,022	H343Y	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tmtc3	A	G	10: 100,472,043		probably benign	Het
Trafd1	C	T	5: 121,373,324	R477H	possibly damaging	Het
Uhrf2	T	A	19: 30,056,226		probably benign	Het
Vmn2r68	T	A	7: 85,222,341	D578V	possibly damaging	Het
Wdcp	G	A	12: 4,851,655	V504I	possibly damaging	Het
Wdr93	T	C	7: 79,773,448	Y487H	probably damaging	Het
Zfp457	T	C	13: 67,293,782	H147R	probably damaging	Het

Other mutations in Nmd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Nmd3	APN	3	69745240	missense	possibly damaging	0.63
IGL01014:Nmd3	APN	3	69726386	missense	probably benign	0.00
IGL01289:Nmd3	APN	3	69724287	missense	possibly damaging	0.85
IGL02566:Nmd3	APN	3	69739914	unclassified	probably benign
IGL03259:Nmd3	APN	3	69745243	missense	possibly damaging	0.49
IGL03299:Nmd3	APN	3	69730429	unclassified	probably null
IGL03382:Nmd3	APN	3	69735088	missense	probably damaging	0.99
R0017:Nmd3	UTSW	3	69736092	splice site	probably null
R0025:Nmd3	UTSW	3	69748321	missense	probably damaging	1.00
R0350:Nmd3	UTSW	3	69743574	missense	probably damaging	1.00
R1635:Nmd3	UTSW	3	69739984	missense	probably benign	0.03
R3081:Nmd3	UTSW	3	69724399	splice site	probably benign
R3686:Nmd3	UTSW	3	69746762	missense	probably damaging	1.00
R3758:Nmd3	UTSW	3	69724308	nonsense	probably null
R4384:Nmd3	UTSW	3	69724398	splice site	probably benign
R4774:Nmd3	UTSW	3	69745236	missense	probably benign	0.11
R4778:Nmd3	UTSW	3	69731591	nonsense	probably null
R4953:Nmd3	UTSW	3	69731637	missense	possibly damaging	0.92
R5000:Nmd3	UTSW	3	69717402	unclassified	probably benign
R5182:Nmd3	UTSW	3	69722468	critical splice donor site	probably null
R6043:Nmd3	UTSW	3	69745247	missense	probably benign
R6355:Nmd3	UTSW	3	69729347	missense	probably benign	0.22
R6760:Nmd3	UTSW	3	69746837	critical splice donor site	probably null
R7869:Nmd3	UTSW	3	69726417	missense	probably damaging	1.00
R7952:Nmd3	UTSW	3	69726417	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGTCACATGAGGAGGTCGCT -3'
(R):5'- GCTTGCCCCTGAAACTGCTTGTA -3'

Sequencing Primer
(F):5'- CTGTAATGTTTCAAAATGGGCTG -3'
(R):5'- TTGTAAGGGTCCAGGAAAGC -3'

Posted On

2014-01-05