Incidental Mutation 'R1026:Olfr304'
ID 94967
Institutional Source Beutler Lab
Gene Symbol Olfr304
Ensembl Gene ENSMUSG00000062426
Gene Name olfactory receptor 304
Synonyms GA_x6K02T2NHDJ-9721756-9722757, MOR219-3P
MMRRC Submission 039128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R1026 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 86385657-86386658 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86386259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 134 (M134L)
Ref Sequence ENSEMBL: ENSMUSP00000076449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077210]
AlphaFold Q7TS03
Predicted Effect probably damaging
Transcript: ENSMUST00000077210
AA Change: M134L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076449
Gene: ENSMUSG00000062426
AA Change: M134L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 8.9e-38 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alyref C G 11: 120,595,932 V168L probably damaging Het
Cdc42bpg T C 19: 6,317,187 C919R probably damaging Het
Cgnl1 A G 9: 71,717,431 S620P possibly damaging Het
Fbxw10 A G 11: 62,875,171 T756A probably benign Het
Fsip2 T C 2: 82,988,461 I4846T possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Map4k5 T C 12: 69,874,288 K52R possibly damaging Het
Neb T A 2: 52,264,110 M2330L possibly damaging Het
Olfr1053 T C 2: 86,315,214 Q24R possibly damaging Het
Plekhf1 C A 7: 38,221,641 A168S probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Prss23 T A 7: 89,509,958 Y301F probably benign Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Zcchc17 C T 4: 130,329,610 V128I possibly damaging Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Other mutations in Olfr304
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Olfr304 APN 7 86386000 missense possibly damaging 0.95
IGL02152:Olfr304 APN 7 86386043 missense probably benign 0.00
IGL02540:Olfr304 APN 7 86386178 missense possibly damaging 0.86
IGL03108:Olfr304 APN 7 86385721 missense possibly damaging 0.95
IGL03374:Olfr304 APN 7 86386366 missense probably damaging 1.00
R0040:Olfr304 UTSW 7 86386507 missense probably benign 0.01
R0130:Olfr304 UTSW 7 86386306 missense probably damaging 1.00
R0194:Olfr304 UTSW 7 86386374 nonsense probably null
R0267:Olfr304 UTSW 7 86386267 missense possibly damaging 0.64
R1865:Olfr304 UTSW 7 86386561 missense probably damaging 1.00
R2090:Olfr304 UTSW 7 86386081 missense probably benign 0.01
R3607:Olfr304 UTSW 7 86385695 missense probably benign
R3861:Olfr304 UTSW 7 86386123 missense possibly damaging 0.60
R3909:Olfr304 UTSW 7 86385974 missense probably benign 0.05
R4113:Olfr304 UTSW 7 86386525 missense possibly damaging 0.83
R5268:Olfr304 UTSW 7 86385659 makesense probably null
R5649:Olfr304 UTSW 7 86386313 missense probably damaging 1.00
R6343:Olfr304 UTSW 7 86385851 nonsense probably null
R7716:Olfr304 UTSW 7 86386054 missense probably benign 0.22
R8118:Olfr304 UTSW 7 86385768 nonsense probably null
R9047:Olfr304 UTSW 7 86386040 missense probably benign 0.05
R9503:Olfr304 UTSW 7 86386020 missense probably benign 0.00
R9528:Olfr304 UTSW 7 86385851 nonsense probably null
X0054:Olfr304 UTSW 7 86385730 missense probably benign 0.00
X0063:Olfr304 UTSW 7 86386492 missense probably damaging 1.00
Z1186:Olfr304 UTSW 7 86386279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGACATCACTGTTCCTCAGGCTG -3'
(R):5'- TGTGTCCATCCCAATCCCAAAGTTC -3'

Sequencing Primer
(F):5'- GCAAATGCTTTGGACTGACC -3'
(R):5'- AGTTCATCATCAATAACCTAACTCAC -3'
Posted On 2014-01-05