Mutagenetix > Incidental Mutations

Incidental Mutation 'R1026:Olfr304'

94967

Institutional Source

Beutler Lab

Gene Symbol

Olfr304

Ensembl Gene

ENSMUSG00000062426

Gene Name

olfactory receptor 304

Synonyms

GA_x6K02T2NHDJ-9721756-9722757, MOR219-3P

MMRRC Submission

039128-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R1026 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86385657-86386658 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86386259 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 134 (M134L)

Ref Sequence

ENSEMBL: ENSMUSP00000076449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077210]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077210
AA Change: M134L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076449
Gene: ENSMUSG00000062426
AA Change: M134L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	8.9e-38	PFAM
Pfam:7tm_1	39	288	1.1e-21	PFAM

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.5%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alyref	C	G	11: 120,595,932	V168L	probably damaging	Het
Cdc42bpg	T	C	19: 6,317,187	C919R	probably damaging	Het
Cgnl1	A	G	9: 71,717,431	S620P	possibly damaging	Het
Fbxw10	A	G	11: 62,875,171	T756A	probably benign	Het
Fsip2	T	C	2: 82,988,461	I4846T	possibly damaging	Het
Hebp2	G	T	10: 18,544,415	T90K	possibly damaging	Het
Map4k5	T	C	12: 69,874,288	K52R	possibly damaging	Het
Neb	T	A	2: 52,264,110	M2330L	possibly damaging	Het
Olfr1053	T	C	2: 86,315,214	Q24R	possibly damaging	Het
Plekhf1	C	A	7: 38,221,641	A168S	probably benign	Het
Ppp1r12a	A	G	10: 108,251,859	T58A	probably benign	Het
Prss23	T	A	7: 89,509,958	Y301F	probably benign	Het
R3hdm1	A	G	1: 128,197,005	Y343C	probably damaging	Het
Zcchc17	C	T	4: 130,329,610	V128I	possibly damaging	Het
Zfp960	T	A	17: 17,088,256	C411S	probably damaging	Het

Other mutations in Olfr304

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Olfr304	APN	7	86386000	missense	possibly damaging	0.95
IGL02152:Olfr304	APN	7	86386043	missense	probably benign	0.00
IGL02540:Olfr304	APN	7	86386178	missense	possibly damaging	0.86
IGL03108:Olfr304	APN	7	86385721	missense	possibly damaging	0.95
IGL03374:Olfr304	APN	7	86386366	missense	probably damaging	1.00
R0040:Olfr304	UTSW	7	86386507	missense	probably benign	0.01
R0130:Olfr304	UTSW	7	86386306	missense	probably damaging	1.00
R0194:Olfr304	UTSW	7	86386374	nonsense	probably null
R0267:Olfr304	UTSW	7	86386267	missense	possibly damaging	0.64
R1865:Olfr304	UTSW	7	86386561	missense	probably damaging	1.00
R2090:Olfr304	UTSW	7	86386081	missense	probably benign	0.01
R3607:Olfr304	UTSW	7	86385695	missense	probably benign
R3861:Olfr304	UTSW	7	86386123	missense	possibly damaging	0.60
R3909:Olfr304	UTSW	7	86385974	missense	probably benign	0.05
R4113:Olfr304	UTSW	7	86386525	missense	possibly damaging	0.83
R5268:Olfr304	UTSW	7	86385659	makesense	probably null
R5649:Olfr304	UTSW	7	86386313	missense	probably damaging	1.00
R6343:Olfr304	UTSW	7	86385851	nonsense	probably null
R7716:Olfr304	UTSW	7	86386054	missense	probably benign	0.22
R8118:Olfr304	UTSW	7	86385768	nonsense	probably null
X0054:Olfr304	UTSW	7	86385730	missense	probably benign	0.00
X0063:Olfr304	UTSW	7	86386492	missense	probably damaging	1.00
Z1186:Olfr304	UTSW	7	86386279	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGACATCACTGTTCCTCAGGCTG -3'
(R):5'- TGTGTCCATCCCAATCCCAAAGTTC -3'

Sequencing Primer
(F):5'- GCAAATGCTTTGGACTGACC -3'
(R):5'- AGTTCATCATCAATAACCTAACTCAC -3'

Posted On

2014-01-05