Incidental Mutation 'R1026:Prss23'
ID94969
Institutional Source Beutler Lab
Gene Symbol Prss23
Ensembl Gene ENSMUSG00000039405
Gene Nameprotease, serine 23
Synonyms2310046G15Rik
MMRRC Submission 039128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1026 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location89507783-89527187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89509958 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 301 (Y301F)
Ref Sequence ENSEMBL: ENSMUSP00000147183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041761] [ENSMUST00000207538] [ENSMUST00000207636] [ENSMUST00000207932] [ENSMUST00000208402] [ENSMUST00000208888] [ENSMUST00000208903]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032858
Predicted Effect probably benign
Transcript: ENSMUST00000041761
AA Change: Y301F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045191
Gene: ENSMUSG00000039405
AA Change: Y301F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 48 57 N/A INTRINSIC
Tryp_SPc 137 372 2.87e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179361
Predicted Effect probably benign
Transcript: ENSMUST00000207538
Predicted Effect probably benign
Transcript: ENSMUST00000207636
Predicted Effect probably benign
Transcript: ENSMUST00000207932
AA Change: Y301F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000208402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208814
Predicted Effect probably benign
Transcript: ENSMUST00000208888
Predicted Effect probably benign
Transcript: ENSMUST00000208903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209118
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alyref C G 11: 120,595,932 V168L probably damaging Het
Cdc42bpg T C 19: 6,317,187 C919R probably damaging Het
Cgnl1 A G 9: 71,717,431 S620P possibly damaging Het
Fbxw10 A G 11: 62,875,171 T756A probably benign Het
Fsip2 T C 2: 82,988,461 I4846T possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Map4k5 T C 12: 69,874,288 K52R possibly damaging Het
Neb T A 2: 52,264,110 M2330L possibly damaging Het
Olfr1053 T C 2: 86,315,214 Q24R possibly damaging Het
Olfr304 T A 7: 86,386,259 M134L probably damaging Het
Plekhf1 C A 7: 38,221,641 A168S probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Zcchc17 C T 4: 130,329,610 V128I possibly damaging Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Other mutations in Prss23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Prss23 APN 7 89509887 missense possibly damaging 0.83
IGL03308:Prss23 APN 7 89509730 missense probably benign 0.09
IGL03349:Prss23 APN 7 89509857 missense probably benign 0.09
IGL03378:Prss23 APN 7 89510144 missense probably damaging 0.99
R0394:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R1417:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1691:Prss23 UTSW 7 89510714 missense probably benign 0.18
R1806:Prss23 UTSW 7 89510391 missense probably damaging 1.00
R2153:Prss23 UTSW 7 89509911 missense probably damaging 1.00
R3420:Prss23 UTSW 7 89509899 missense possibly damaging 0.91
R3849:Prss23 UTSW 7 89509751 missense probably damaging 1.00
R4567:Prss23 UTSW 7 89510866 utr 5 prime probably benign
R4828:Prss23 UTSW 7 89509900 nonsense probably null
R5010:Prss23 UTSW 7 89510214 missense probably benign 0.25
R5251:Prss23 UTSW 7 89510322 missense probably damaging 1.00
R5399:Prss23 UTSW 7 89509966 missense probably benign 0.02
R5629:Prss23 UTSW 7 89510192 missense probably damaging 1.00
R5697:Prss23 UTSW 7 89509982 missense probably damaging 0.99
R6378:Prss23 UTSW 7 89510033 missense probably damaging 1.00
R6716:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R6880:Prss23 UTSW 7 89510825 missense probably benign 0.03
R7097:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R7362:Prss23 UTSW 7 89509764 missense probably damaging 1.00
R7563:Prss23 UTSW 7 89509830 missense probably damaging 1.00
R7637:Prss23 UTSW 7 89510246 missense probably benign 0.00
R7815:Prss23 UTSW 7 89510045 missense probably damaging 0.99
R8047:Prss23 UTSW 7 89509928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAGAGCCATTCATGTCCACC -3'
(R):5'- TCAGCCATGCCAGACAAGATGAAG -3'

Sequencing Primer
(F):5'- ATTCATGTCCACCCACTGG -3'
(R):5'- CATCGGCATGGATTATGACTACG -3'
Posted On2014-01-05