Incidental Mutation 'R1136:Gpbp1l1'
ID 94976
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene Name GC-rich promoter binding protein 1-like 1
Synonyms 5330440M15Rik
MMRRC Submission 039209-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1136 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 116414855-116451079 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 116450115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 461 (T461M)
Ref Sequence ENSEMBL: ENSMUSP00000102083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000051869] [ENSMUST00000106475]
AlphaFold Q6NZP2
Predicted Effect probably damaging
Transcript: ENSMUST00000030460
AA Change: T461M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042
AA Change: T461M

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051869
SMART Domains Protein: ENSMUSP00000059848
Gene: ENSMUSG00000034035

DomainStartEndE-ValueType
coiled coil region 97 161 N/A INTRINSIC
coiled coil region 219 270 N/A INTRINSIC
low complexity region 415 427 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106475
AA Change: T461M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042
AA Change: T461M

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151441
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,878,436 (GRCm39) G401S probably damaging Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Bmp2 T C 2: 133,402,847 (GRCm39) F133L probably damaging Het
C1qtnf3 A G 15: 10,978,670 (GRCm39) E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 (GRCm39) D701E probably benign Het
Chmp7 C T 14: 69,956,899 (GRCm39) M336I probably benign Het
Csmd3 A T 15: 47,539,213 (GRCm39) I1508N probably damaging Het
Dgkh T C 14: 78,862,329 (GRCm39) R80G probably damaging Het
Dock1 T A 7: 134,449,902 (GRCm39) V805D possibly damaging Het
Eef2 C CN 10: 81,014,603 (GRCm39) probably null Het
Ercc6l2 T A 13: 64,016,934 (GRCm39) V679D possibly damaging Het
Esp6 T C 17: 40,876,284 (GRCm39) Y111H probably benign Het
Focad T C 4: 88,244,417 (GRCm39) F799S unknown Het
Foxred1 C A 9: 35,116,333 (GRCm39) M438I probably benign Het
Galnt11 T G 5: 25,463,943 (GRCm39) V405G probably damaging Het
Gm4847 A G 1: 166,457,935 (GRCm39) Y473H probably damaging Het
Hnrnpu A T 1: 178,158,790 (GRCm39) probably benign Het
Kmt2d A T 15: 98,755,646 (GRCm39) probably benign Het
Matr3 A G 18: 35,705,948 (GRCm39) H291R probably damaging Het
Mfsd14b C T 13: 65,243,506 (GRCm39) S46N probably benign Het
Mtch1 C T 17: 29,552,744 (GRCm39) probably null Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Mylk T C 16: 34,820,688 (GRCm39) I1880T probably damaging Het
N4bp2 T C 5: 65,965,815 (GRCm39) L1288P probably damaging Het
Ncf2 A T 1: 152,706,123 (GRCm39) H245L probably damaging Het
Nmd3 T A 3: 69,654,049 (GRCm39) probably benign Het
Npdc1 G T 2: 25,297,727 (GRCm39) A127S probably benign Het
Nudt3 C A 17: 27,842,080 (GRCm39) R27L probably benign Het
Nwd1 C T 8: 73,424,397 (GRCm39) probably benign Het
Pex7 T A 10: 19,764,434 (GRCm39) I170F probably benign Het
Phyhipl A G 10: 70,404,902 (GRCm39) V57A probably damaging Het
Pkhd1 G A 1: 20,593,053 (GRCm39) P1687S possibly damaging Het
Plekhj1 A T 10: 80,633,654 (GRCm39) probably null Het
Prss21 T A 17: 24,091,968 (GRCm39) L312H probably damaging Het
Samsn1 T C 16: 75,670,408 (GRCm39) I232V probably null Het
Sec63 A T 10: 42,682,542 (GRCm39) D411V probably damaging Het
Slc44a4 C T 17: 35,146,998 (GRCm39) H343Y probably damaging Het
Sucla2 C T 14: 73,798,074 (GRCm39) probably benign Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tent2 C T 13: 93,312,205 (GRCm39) probably null Het
Tmtc3 A G 10: 100,307,905 (GRCm39) probably benign Het
Trafd1 C T 5: 121,511,387 (GRCm39) R477H possibly damaging Het
Uhrf2 T A 19: 30,033,626 (GRCm39) probably benign Het
Vmn2r68 T A 7: 84,871,549 (GRCm39) D578V possibly damaging Het
Wdcp G A 12: 4,901,655 (GRCm39) V504I possibly damaging Het
Wdr93 T C 7: 79,423,196 (GRCm39) Y487H probably damaging Het
Zfp457 T C 13: 67,441,846 (GRCm39) H147R probably damaging Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116,444,710 (GRCm39) critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116,431,740 (GRCm39) missense probably benign
R0534:Gpbp1l1 UTSW 4 116,448,465 (GRCm39) missense probably damaging 1.00
R0964:Gpbp1l1 UTSW 4 116,438,436 (GRCm39) splice site probably benign
R1169:Gpbp1l1 UTSW 4 116,431,563 (GRCm39) missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116,428,182 (GRCm39) critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116,444,656 (GRCm39) missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116,447,462 (GRCm39) missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116,430,714 (GRCm39) missense probably benign
R5086:Gpbp1l1 UTSW 4 116,445,789 (GRCm39) missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116,447,457 (GRCm39) missense probably benign 0.00
R6486:Gpbp1l1 UTSW 4 116,438,572 (GRCm39) missense probably damaging 0.99
R6604:Gpbp1l1 UTSW 4 116,430,702 (GRCm39) missense probably benign 0.09
R6973:Gpbp1l1 UTSW 4 116,438,479 (GRCm39) missense possibly damaging 0.53
R7031:Gpbp1l1 UTSW 4 116,450,045 (GRCm39) missense probably damaging 1.00
R7230:Gpbp1l1 UTSW 4 116,445,807 (GRCm39) missense probably damaging 0.99
R7286:Gpbp1l1 UTSW 4 116,447,442 (GRCm39) missense probably benign 0.02
R7368:Gpbp1l1 UTSW 4 116,430,655 (GRCm39) missense probably benign 0.04
R7791:Gpbp1l1 UTSW 4 116,431,617 (GRCm39) missense probably damaging 1.00
R9475:Gpbp1l1 UTSW 4 116,431,558 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAATTCCCCTCCACATACTCCTCTAGAC -3'
(R):5'- TGCCCTGACAGCTCCCACTT -3'

Sequencing Primer
(F):5'- ATGGCCTCTTACAAAGCCGT -3'
(R):5'- AAGACAATTGCTCTCTCTTTGGG -3'
Posted On 2014-01-05