Incidental Mutation 'R1136:Galnt11'
ID94978
Institutional Source Beutler Lab
Gene Symbol Galnt11
Ensembl Gene ENSMUSG00000038072
Gene Namepolypeptide N-acetylgalactosaminyltransferase 11
SynonymsA430075I06Rik, E430002F06Rik
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R1136 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location25221904-25265918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25258945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 405 (V405G)
Ref Sequence ENSEMBL: ENSMUSP00000110602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045737] [ENSMUST00000114950] [ENSMUST00000114952]
Predicted Effect probably damaging
Transcript: ENSMUST00000045737
AA Change: V405G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036240
Gene: ENSMUSG00000038072
AA Change: V405G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 386 5.3e-9 PFAM
Pfam:Glycos_transf_2 154 337 3.7e-33 PFAM
Pfam:Glyco_transf_7C 315 383 2.1e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114950
AA Change: V405G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110600
Gene: ENSMUSG00000038072
AA Change: V405G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 385 1.7e-10 PFAM
Pfam:Glycos_transf_2 154 337 4.8e-29 PFAM
Pfam:Glyco_transf_7C 314 383 3.5e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114952
AA Change: V405G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110602
Gene: ENSMUSG00000038072
AA Change: V405G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 385 1.7e-10 PFAM
Pfam:Glycos_transf_2 154 337 4.8e-29 PFAM
Pfam:Glyco_transf_7C 314 383 3.5e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Meta Mutation Damage Score 0.7253 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Galnt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Galnt11 APN 5 25248831 splice site probably benign
IGL01553:Galnt11 APN 5 25247720 missense probably benign 0.13
IGL01748:Galnt11 APN 5 25247515 nonsense probably null
R0021:Galnt11 UTSW 5 25248857 missense probably damaging 1.00
R0021:Galnt11 UTSW 5 25248857 missense probably damaging 1.00
R0666:Galnt11 UTSW 5 25252147 missense possibly damaging 0.89
R0784:Galnt11 UTSW 5 25258909 missense probably damaging 1.00
R1168:Galnt11 UTSW 5 25250246 missense probably damaging 1.00
R1617:Galnt11 UTSW 5 25258893 missense probably damaging 1.00
R2033:Galnt11 UTSW 5 25247538 missense probably damaging 1.00
R2507:Galnt11 UTSW 5 25247612 missense probably damaging 1.00
R2508:Galnt11 UTSW 5 25247612 missense probably damaging 1.00
R4237:Galnt11 UTSW 5 25265260 missense probably benign 0.02
R4944:Galnt11 UTSW 5 25265338 missense probably damaging 1.00
R5653:Galnt11 UTSW 5 25248858 missense probably damaging 1.00
R5917:Galnt11 UTSW 5 25247672 intron probably null
R6489:Galnt11 UTSW 5 25264966 missense probably damaging 0.99
R6696:Galnt11 UTSW 5 25255114 missense probably benign
R6709:Galnt11 UTSW 5 25248853 missense probably damaging 1.00
R6881:Galnt11 UTSW 5 25250099 missense possibly damaging 0.69
R7034:Galnt11 UTSW 5 25258813 missense probably damaging 0.99
R7036:Galnt11 UTSW 5 25258813 missense probably damaging 0.99
X0038:Galnt11 UTSW 5 25257494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTAAGCTGCATAGCCACCATTC -3'
(R):5'- TGAGCGATCAGTGAGGTCCAGAAC -3'

Sequencing Primer
(F):5'- CATGAAGATGTGCGCTGC -3'
(R):5'- AGAACTGCTTCCGATGCTTG -3'
Posted On2014-01-05