Incidental Mutation 'R1026:Cdc42bpg'
ID94998
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission 039128-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R1026 (G1)
Quality Score193
Status Not validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6317187 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 919 (C919R)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: C919R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: C919R

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141854
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alyref C G 11: 120,595,932 V168L probably damaging Het
Cgnl1 A G 9: 71,717,431 S620P possibly damaging Het
Fbxw10 A G 11: 62,875,171 T756A probably benign Het
Fsip2 T C 2: 82,988,461 I4846T possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Map4k5 T C 12: 69,874,288 K52R possibly damaging Het
Neb T A 2: 52,264,110 M2330L possibly damaging Het
Olfr1053 T C 2: 86,315,214 Q24R possibly damaging Het
Olfr304 T A 7: 86,386,259 M134L probably damaging Het
Plekhf1 C A 7: 38,221,641 A168S probably benign Het
Ppp1r12a A G 10: 108,251,859 T58A probably benign Het
Prss23 T A 7: 89,509,958 Y301F probably benign Het
R3hdm1 A G 1: 128,197,005 Y343C probably damaging Het
Zcchc17 C T 4: 130,329,610 V128I possibly damaging Het
Zfp960 T A 17: 17,088,256 C411S probably damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7426:Cdc42bpg UTSW 19 6318398 missense probably damaging 1.00
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
R7739:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R7903:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R7986:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6309746 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6314522 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6314523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCACTCACGTCTCTTATCAAGC -3'
(R):5'- CATGAGATACCGCCCCTGAATGAAC -3'

Sequencing Primer
(F):5'- ATCAAGCTCTCCAACTTAGTTACTC -3'
(R):5'- TCTGGGACCTACCTTAGATCCAAG -3'
Posted On2014-01-05