Incidental Mutation 'R1136:Nwd1'
ID95003
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene NameNACHT and WD repeat domain containing 1
SynonymsA230063L24Rik
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1136 (G1)
Quality Score215
Status Validated
Chromosome8
Chromosomal Location72646711-72717876 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 72697769 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
Predicted Effect probably benign
Transcript: ENSMUST00000093427
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably benign
Transcript: ENSMUST00000161254
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161386
SMART Domains Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 1.2e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 984 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect probably benign
Transcript: ENSMUST00000228312
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 72671077 missense probably damaging 0.99
IGL01294:Nwd1 APN 8 72711745 missense probably damaging 1.00
IGL01298:Nwd1 APN 8 72662331 missense probably benign 0.00
IGL01333:Nwd1 APN 8 72666811 missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 72675115 missense probably damaging 1.00
IGL02244:Nwd1 APN 8 72707582 missense probably damaging 1.00
IGL02579:Nwd1 APN 8 72707527 missense probably damaging 1.00
IGL02608:Nwd1 APN 8 72667375 missense probably damaging 1.00
IGL02632:Nwd1 APN 8 72667454 missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 72667501 missense probably damaging 1.00
IGL03010:Nwd1 APN 8 72688060 splice site probably benign
R0017:Nwd1 UTSW 8 72709425 splice site probably benign
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0505:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0511:Nwd1 UTSW 8 72682005 missense probably damaging 1.00
R0612:Nwd1 UTSW 8 72667680 missense probably damaging 0.99
R0681:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0763:Nwd1 UTSW 8 72671044 missense probably damaging 1.00
R0905:Nwd1 UTSW 8 72709449 missense probably damaging 0.99
R1483:Nwd1 UTSW 8 72657086 missense probably damaging 0.96
R1630:Nwd1 UTSW 8 72667029 missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 72711620 missense probably damaging 1.00
R1732:Nwd1 UTSW 8 72666835 missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 72704994 missense probably benign 0.00
R1973:Nwd1 UTSW 8 72704962 missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 72662427 missense probably benign
R2926:Nwd1 UTSW 8 72667012 missense probably damaging 1.00
R3706:Nwd1 UTSW 8 72667116 missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 72667811 nonsense probably null
R3917:Nwd1 UTSW 8 72667811 nonsense probably null
R4153:Nwd1 UTSW 8 72681936 missense probably damaging 1.00
R4426:Nwd1 UTSW 8 72666795 missense probably damaging 1.00
R4435:Nwd1 UTSW 8 72688136 missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 72670951 missense probably damaging 1.00
R4622:Nwd1 UTSW 8 72667300 missense probably damaging 1.00
R4659:Nwd1 UTSW 8 72695321 missense probably benign 0.03
R4694:Nwd1 UTSW 8 72667330 missense probably damaging 1.00
R4837:Nwd1 UTSW 8 72657131 missense probably damaging 1.00
R4844:Nwd1 UTSW 8 72667114 missense probably damaging 1.00
R4906:Nwd1 UTSW 8 72672213 missense probably damaging 1.00
R5041:Nwd1 UTSW 8 72705055 missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 72671086 missense probably benign 0.07
R5416:Nwd1 UTSW 8 72666694 missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 72704976 missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5699:Nwd1 UTSW 8 72702974 critical splice donor site probably null
R5722:Nwd1 UTSW 8 72675244 missense probably damaging 0.97
R5762:Nwd1 UTSW 8 72670914 missense probably damaging 1.00
R5778:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5992:Nwd1 UTSW 8 72653573 critical splice donor site probably null
R6163:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6164:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6165:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6212:Nwd1 UTSW 8 72695322 missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 72662366 missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 72657062 missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 72682025 missense probably benign 0.27
R6944:Nwd1 UTSW 8 72653534 missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 72667660 missense probably damaging 1.00
R7060:Nwd1 UTSW 8 72666694 missense probably damaging 1.00
R7102:Nwd1 UTSW 8 72695329 missense probably damaging 1.00
R7265:Nwd1 UTSW 8 72692928 missense probably benign 0.29
R7343:Nwd1 UTSW 8 72711782 missense probably damaging 0.98
R7391:Nwd1 UTSW 8 72662418 missense probably damaging 0.99
R7424:Nwd1 UTSW 8 72675173 missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 72707830 missense probably benign 0.00
R7487:Nwd1 UTSW 8 72666638 missense unknown
R7502:Nwd1 UTSW 8 72707393 missense probably damaging 0.98
R7883:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
R8235:Nwd1 UTSW 8 72711686 frame shift probably null
R8235:Nwd1 UTSW 8 72711689 frame shift probably null
R8282:Nwd1 UTSW 8 72704952 missense probably damaging 0.99
X0067:Nwd1 UTSW 8 72667256 missense possibly damaging 0.81
Z1176:Nwd1 UTSW 8 72672300 missense not run
Z1177:Nwd1 UTSW 8 72666628 missense probably damaging 0.97
Z1177:Nwd1 UTSW 8 72695387 missense possibly damaging 0.48
Z1177:Nwd1 UTSW 8 72709459 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCAGGTGCAGGTGACATCAG -3'
(R):5'- ACTAGTGCCAGGTCTCACCCAG -3'

Sequencing Primer
(F):5'- accctcctccctccacc -3'
(R):5'- GTCTCACCCAGCCTCCAG -3'
Posted On2014-01-05