Incidental Mutation 'R1136:Foxred1'
ID95007
Institutional Source Beutler Lab
Gene Symbol Foxred1
Ensembl Gene ENSMUSG00000039048
Gene NameFAD-dependent oxidoreductase domain containing 1
SynonymsTex23, TEG-23
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1136 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35204206-35211055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35205037 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 438 (M438I)
Ref Sequence ENSEMBL: ENSMUSP00000038924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043805] [ENSMUST00000127996] [ENSMUST00000135054] [ENSMUST00000138287] [ENSMUST00000138692] [ENSMUST00000139703] [ENSMUST00000142595] [ENSMUST00000151658] [ENSMUST00000154691] [ENSMUST00000175765]
Predicted Effect probably benign
Transcript: ENSMUST00000043805
AA Change: M438I

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038924
Gene: ENSMUSG00000039048
AA Change: M438I

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 462 2.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127996
AA Change: M432I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118037
Gene: ENSMUSG00000039048
AA Change: M432I

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 456 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130072
Predicted Effect probably benign
Transcript: ENSMUST00000135054
SMART Domains Protein: ENSMUSP00000115301
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
Pfam:DAO 3 140 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138287
Predicted Effect probably benign
Transcript: ENSMUST00000138692
SMART Domains Protein: ENSMUSP00000120556
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139703
SMART Domains Protein: ENSMUSP00000122535
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 184 1.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140177
Predicted Effect probably benign
Transcript: ENSMUST00000142595
SMART Domains Protein: ENSMUSP00000117147
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 187 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151082
Predicted Effect probably benign
Transcript: ENSMUST00000151658
SMART Domains Protein: ENSMUSP00000120284
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 121 5.8e-9 PFAM
low complexity region 128 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154691
SMART Domains Protein: ENSMUSP00000123496
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175765
SMART Domains Protein: ENSMUSP00000135435
Gene: ENSMUSG00000032041

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 65 107 N/A INTRINSIC
Pfam:TIR 113 206 2.4e-8 PFAM
Pfam:TIR_2 116 226 1.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216618
Meta Mutation Damage Score 0.2257 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a FAD-dependent oxidoreductase domain. The encoded protein is localized to the mitochondria and may function as a chaperone protein required for the function of mitochondrial complex I. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Foxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02163:Foxred1 APN 9 35205896 missense probably damaging 1.00
IGL02314:Foxred1 APN 9 35205968 missense probably damaging 1.00
IGL02379:Foxred1 APN 9 35209986 missense probably benign 0.44
IGL02558:Foxred1 APN 9 35210133 missense probably damaging 1.00
PIT4494001:Foxred1 UTSW 9 35209059 missense possibly damaging 0.95
R0220:Foxred1 UTSW 9 35209453 missense probably damaging 1.00
R0605:Foxred1 UTSW 9 35204882 missense possibly damaging 0.68
R0763:Foxred1 UTSW 9 35207473 splice site probably null
R1449:Foxred1 UTSW 9 35209442 missense probably damaging 1.00
R1757:Foxred1 UTSW 9 35210834 missense probably benign 0.16
R2157:Foxred1 UTSW 9 35205363 missense probably damaging 1.00
R2434:Foxred1 UTSW 9 35205658 missense probably damaging 0.99
R3713:Foxred1 UTSW 9 35210890 start codon destroyed probably null
R4012:Foxred1 UTSW 9 35206275 missense possibly damaging 0.48
R4666:Foxred1 UTSW 9 35210855 intron probably benign
R4934:Foxred1 UTSW 9 35209914 intron probably benign
R5488:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5489:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5828:Foxred1 UTSW 9 35210196 intron probably benign
R5840:Foxred1 UTSW 9 35210139 missense probably damaging 0.99
R7037:Foxred1 UTSW 9 35207548 missense probably benign 0.04
R7599:Foxred1 UTSW 9 35205636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATTCCATGTCCAGAGACACCG -3'
(R):5'- GCCCTTTAGCAGATGATCCTGAGC -3'

Sequencing Primer
(F):5'- TGAGGCCCAGAGACAGTTTTC -3'
(R):5'- ATGATCCTGAGCAAGGGTGTG -3'
Posted On2014-01-05