Incidental Mutation 'R1136:Sec63'
ID95013
Institutional Source Beutler Lab
Gene Symbol Sec63
Ensembl Gene ENSMUSG00000019802
Gene NameSEC63-like (S. cerevisiae)
Synonyms
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1136 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location42761496-42832514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42806546 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 411 (D411V)
Ref Sequence ENSEMBL: ENSMUSP00000019937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019937]
Predicted Effect probably damaging
Transcript: ENSMUST00000019937
AA Change: D411V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019937
Gene: ENSMUSG00000019802
AA Change: D411V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
DnaJ 103 157 6.14e-23 SMART
Blast:Sec63 170 208 9e-6 BLAST
Sec63 219 714 6.98e-10 SMART
low complexity region 734 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155410
Meta Mutation Damage Score 0.5962 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Sec63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Sec63 APN 10 42812457 missense possibly damaging 0.56
IGL02111:Sec63 APN 10 42810888 missense probably damaging 1.00
IGL02457:Sec63 APN 10 42801733 splice site probably benign
IGL02613:Sec63 APN 10 42801707 missense probably damaging 1.00
IGL03002:Sec63 APN 10 42810909 missense possibly damaging 0.51
IGL03493:Sec63 APN 10 42828941 missense probably benign 0.06
cyst UTSW 10 42828865 intron probably null
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0538:Sec63 UTSW 10 42798799 missense probably benign 0.01
R0734:Sec63 UTSW 10 42796208 missense probably benign 0.08
R0906:Sec63 UTSW 10 42801928 missense probably damaging 0.98
R1665:Sec63 UTSW 10 42798728 intron probably null
R1736:Sec63 UTSW 10 42827918 nonsense probably null
R1961:Sec63 UTSW 10 42823886 missense probably damaging 1.00
R2696:Sec63 UTSW 10 42783526 missense probably benign 0.05
R4886:Sec63 UTSW 10 42789393 nonsense probably null
R4908:Sec63 UTSW 10 42805190 missense probably damaging 0.99
R5174:Sec63 UTSW 10 42829081 utr 3 prime probably benign
R5619:Sec63 UTSW 10 42789382 missense probably damaging 1.00
R5766:Sec63 UTSW 10 42801681 missense probably damaging 0.99
R5820:Sec63 UTSW 10 42796245 missense possibly damaging 0.49
R6232:Sec63 UTSW 10 42828865 intron probably null
R6656:Sec63 UTSW 10 42816383 nonsense probably null
R6847:Sec63 UTSW 10 42791253 missense probably damaging 1.00
R6971:Sec63 UTSW 10 42783442 missense probably damaging 1.00
R8037:Sec63 UTSW 10 42783487 missense probably benign 0.00
RF010:Sec63 UTSW 10 42806624 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGTAGAGGCCACCTGTACTTAGAAGG -3'
(R):5'- ACGTTTGAAGGAGCCTGACCTAAAAG -3'

Sequencing Primer
(F):5'- GACAATAGTTACTGATTGGATCAGG -3'
(R):5'- ggagcctgacctaaaagtaaatg -3'
Posted On2014-01-05