Incidental Mutation 'R1028:Olfr1297'
ID 95015
Institutional Source Beutler Lab
Gene Symbol Olfr1297
Ensembl Gene ENSMUSG00000094858
Gene Name olfactory receptor 1297
Synonyms GA_x6K02T2Q125-72673494-72672556, MOR248-4
MMRRC Submission 039130-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R1028 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111615233-111626497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111621525 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 183 (L183Q)
Ref Sequence ENSEMBL: ENSMUSP00000150543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000207283] [ENSMUST00000213398]
AlphaFold Q8VGE8
Predicted Effect probably damaging
Transcript: ENSMUST00000099612
AA Change: L183Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: L183Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7tm_1 41 287 6.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207283
AA Change: L183Q
Predicted Effect probably damaging
Transcript: ENSMUST00000213398
AA Change: L183Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.8%
  • 20x: 78.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 12: 105,710,189 probably benign Het
Ano8 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC 8: 71,480,971 probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bpifb9a G C 2: 154,262,407 E257Q possibly damaging Het
Cdh19 T C 1: 110,954,584 I59M probably benign Het
Cmah A G 13: 24,435,662 D171G probably damaging Het
Colec12 T C 18: 9,866,837 S683P unknown Het
Dixdc1 C T 9: 50,703,246 A168T probably benign Het
Dpp6 A G 5: 27,666,427 D461G probably benign Het
Entpd3 A G 9: 120,558,361 H208R probably benign Het
Fuz T C 7: 44,896,926 I39T probably damaging Het
Gprin3 T C 6: 59,354,609 N238D possibly damaging Het
Itpr3 G T 17: 27,091,369 A403S probably benign Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mtor G C 4: 148,538,830 G2046R possibly damaging Het
Myh13 T C 11: 67,356,181 S1243P possibly damaging Het
Net1 A T 13: 3,884,375 C441S probably damaging Het
Nlrp4e T C 7: 23,321,744 F552S probably damaging Het
Olfr1387 G A 11: 49,460,220 M180I probably benign Het
Olfr1504 C A 19: 13,887,795 Q138H probably damaging Het
Ovch2 T C 7: 107,796,548 I88V probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pkhd1 A G 1: 20,117,726 Y3453H probably damaging Het
Rabgef1 T G 5: 130,212,862 L369* probably null Het
Rufy1 A T 11: 50,414,598 probably null Het
Sec16b T C 1: 157,560,917 V618A probably benign Het
Sh3rf1 A G 8: 61,393,787 R876G possibly damaging Het
Slc26a8 A G 17: 28,672,798 Y126H probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zp1 G A 19: 10,918,911 T150I probably benign Het
Other mutations in Olfr1297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr1297 APN 2 111621340 missense probably damaging 1.00
IGL01305:Olfr1297 APN 2 111621201 missense probably damaging 1.00
IGL01903:Olfr1297 APN 2 111621658 missense probably benign 0.01
IGL01984:Olfr1297 APN 2 111621582 missense probably benign 0.34
IGL03065:Olfr1297 APN 2 111621190 missense probably damaging 0.98
ANU22:Olfr1297 UTSW 2 111621201 missense probably damaging 1.00
R0313:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R0615:Olfr1297 UTSW 2 111621919 missense possibly damaging 0.95
R1078:Olfr1297 UTSW 2 111621345 missense probably damaging 1.00
R1158:Olfr1297 UTSW 2 111621741 missense probably damaging 1.00
R1419:Olfr1297 UTSW 2 111621295 missense probably benign 0.05
R1980:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R1981:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R2044:Olfr1297 UTSW 2 111621814 missense probably benign 0.02
R2080:Olfr1297 UTSW 2 111621739 missense probably benign
R2170:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R4494:Olfr1297 UTSW 2 111621148 nonsense probably null
R4965:Olfr1297 UTSW 2 111621534 missense probably damaging 1.00
R5175:Olfr1297 UTSW 2 111621426 missense possibly damaging 0.78
R5891:Olfr1297 UTSW 2 111621433 missense probably damaging 1.00
R6192:Olfr1297 UTSW 2 111621175 missense possibly damaging 0.91
R6383:Olfr1297 UTSW 2 111621186 missense probably benign 0.10
R6730:Olfr1297 UTSW 2 111621735 missense probably damaging 0.96
R7189:Olfr1297 UTSW 2 111621193 missense probably benign 0.03
R7193:Olfr1297 UTSW 2 111621255 missense probably damaging 1.00
R7199:Olfr1297 UTSW 2 111621193 missense probably benign 0.01
R7735:Olfr1297 UTSW 2 111621474 missense probably damaging 1.00
R8017:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
R8019:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
R8285:Olfr1297 UTSW 2 111622045 missense probably benign 0.32
R8419:Olfr1297 UTSW 2 111621504 missense probably benign 0.10
R9258:Olfr1297 UTSW 2 111621984 missense possibly damaging 0.77
X0063:Olfr1297 UTSW 2 111621381 missense probably benign 0.04
Z1176:Olfr1297 UTSW 2 111621261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGTGGACAGAGCCTTGGAAG -3'
(R):5'- TCCTTTGCAGGATGCATGTCCC -3'

Sequencing Primer
(F):5'- GAAGCTCCAGTTTTCGAATTCTG -3'
(R):5'- AATGGCCTATGACCGCTATG -3'
Posted On 2014-01-05