Incidental Mutation 'R1136:Plekhj1'
ID95018
Institutional Source Beutler Lab
Gene Symbol Plekhj1
Ensembl Gene ENSMUSG00000035278
Gene Namepleckstrin homology domain containing, family J member 1
Synonyms9530063M10Rik
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1136 (G1)
Quality Score203
Status Validated
Chromosome10
Chromosomal Location80796099-80798626 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 80797820 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036805] [ENSMUST00000105336] [ENSMUST00000127740] [ENSMUST00000147440] [ENSMUST00000148665] [ENSMUST00000149394] [ENSMUST00000150338] [ENSMUST00000151928] [ENSMUST00000218209] [ENSMUST00000219378] [ENSMUST00000219959]
Predicted Effect probably damaging
Transcript: ENSMUST00000036805
AA Change: L61Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042334
Gene: ENSMUSG00000035278
AA Change: L61Q

DomainStartEndE-ValueType
PH 16 110 1.48e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105336
SMART Domains Protein: ENSMUSP00000100973
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 115 317 9.4e-86 PFAM
low complexity region 335 348 N/A INTRINSIC
AT_hook 407 419 4.64e-1 SMART
low complexity region 437 447 N/A INTRINSIC
coiled coil region 558 647 N/A INTRINSIC
low complexity region 917 936 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1145 1157 N/A INTRINSIC
low complexity region 1186 1198 N/A INTRINSIC
low complexity region 1436 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127740
Predicted Effect probably benign
Transcript: ENSMUST00000138505
SMART Domains Protein: ENSMUSP00000119492
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
low complexity region 92 137 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139461
Predicted Effect probably null
Transcript: ENSMUST00000147440
SMART Domains Protein: ENSMUSP00000116478
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Blast:CactinC_cactus 41 67 1e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000148665
SMART Domains Protein: ENSMUSP00000117160
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 219 8.29e-35 SMART
low complexity region 300 318 N/A INTRINSIC
low complexity region 320 420 N/A INTRINSIC
low complexity region 423 452 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149394
SMART Domains Protein: ENSMUSP00000127762
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150338
SMART Domains Protein: ENSMUSP00000116581
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 1 100 3.4e-37 PFAM
low complexity region 118 131 N/A INTRINSIC
AT_hook 190 202 4.64e-1 SMART
low complexity region 220 230 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
SCOP:d1fxkc_ 396 441 1e-3 SMART
low complexity region 700 719 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 969 981 N/A INTRINSIC
low complexity region 1020 1032 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
low complexity region 1060 1105 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151928
SMART Domains Protein: ENSMUSP00000114164
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 194 1.26e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218036
Predicted Effect probably benign
Transcript: ENSMUST00000218209
Predicted Effect silent
Transcript: ENSMUST00000219378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219767
Predicted Effect probably benign
Transcript: ENSMUST00000219959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220093
Meta Mutation Damage Score 0.7292 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Plekhj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Plekhj1 APN 10 80796602 unclassified probably null
IGL02523:Plekhj1 APN 10 80797849 splice site probably null
PIT4403001:Plekhj1 UTSW 10 80796459 missense unknown
R0016:Plekhj1 UTSW 10 80796416 missense possibly damaging 0.90
R0288:Plekhj1 UTSW 10 80796610 missense probably damaging 1.00
R2262:Plekhj1 UTSW 10 80796472 missense probably benign 0.01
R3937:Plekhj1 UTSW 10 80797775 missense probably damaging 0.99
R3938:Plekhj1 UTSW 10 80797775 missense probably damaging 0.99
R4938:Plekhj1 UTSW 10 80797775 missense probably damaging 1.00
R7231:Plekhj1 UTSW 10 80797658 missense probably damaging 0.96
R7546:Plekhj1 UTSW 10 80797914 missense possibly damaging 0.52
R7782:Plekhj1 UTSW 10 80798345 unclassified probably benign
R7993:Plekhj1 UTSW 10 80797945 missense probably damaging 1.00
RF018:Plekhj1 UTSW 10 80796637 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGGCCTTACTGGCATACTCACAC -3'
(R):5'- ATGAGAACAGTTCCGCGCTGACAC -3'

Sequencing Primer
(F):5'- ggcatactcacacCCCAAAAC -3'
(R):5'- CACCGCCCTGTGCCTAC -3'
Posted On2014-01-05