Incidental Mutation 'R1028:Nlrp4e'
ID95036
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene NameNLR family, pyrin domain containing 4E
Synonyms4930406H16Rik, Nalp4e, Nalp-epsilon
MMRRC Submission 039130-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1028 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23301192-23362277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23321744 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 552 (F552S)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
Predicted Effect probably damaging
Transcript: ENSMUST00000076470
AA Change: F552S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: F552S

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.8%
  • 20x: 78.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 12: 105,710,189 probably benign Het
Ano8 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC 8: 71,480,971 probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bpifb9a G C 2: 154,262,407 E257Q possibly damaging Het
Cdh19 T C 1: 110,954,584 I59M probably benign Het
Cmah A G 13: 24,435,662 D171G probably damaging Het
Colec12 T C 18: 9,866,837 S683P unknown Het
Dixdc1 C T 9: 50,703,246 A168T probably benign Het
Dpp6 A G 5: 27,666,427 D461G probably benign Het
Entpd3 A G 9: 120,558,361 H208R probably benign Het
Fuz T C 7: 44,896,926 I39T probably damaging Het
Gprin3 T C 6: 59,354,609 N238D possibly damaging Het
Itpr3 G T 17: 27,091,369 A403S probably benign Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mtor G C 4: 148,538,830 G2046R possibly damaging Het
Myh13 T C 11: 67,356,181 S1243P possibly damaging Het
Net1 A T 13: 3,884,375 C441S probably damaging Het
Olfr1297 A T 2: 111,621,525 L183Q probably damaging Het
Olfr1387 G A 11: 49,460,220 M180I probably benign Het
Olfr1504 C A 19: 13,887,795 Q138H probably damaging Het
Ovch2 T C 7: 107,796,548 I88V probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pkhd1 A G 1: 20,117,726 Y3453H probably damaging Het
Rabgef1 T G 5: 130,212,862 L369* probably null Het
Rufy1 A T 11: 50,414,598 probably null Het
Sec16b T C 1: 157,560,917 V618A probably benign Het
Sh3rf1 A G 8: 61,393,787 R876G possibly damaging Het
Slc26a8 A G 17: 28,672,798 Y126H probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zp1 G A 19: 10,918,911 T150I probably benign Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAGCCATGTAGACCATCCTAGCC -3'
(R):5'- GGAAAGAGTGAATGGACTCACGTATAGC -3'

Sequencing Primer
(F):5'- TCCTAGCCAGGATGTCAAAAG -3'
(R):5'- AGCTGTGTTCTTGACCTTCAC -3'
Posted On2014-01-05