Incidental Mutation 'R1028:Entpd3'
ID95054
Institutional Source Beutler Lab
Gene Symbol Entpd3
Ensembl Gene ENSMUSG00000041608
Gene Nameectonucleoside triphosphate diphosphohydrolase 3
SynonymsHB6, Cd39l3, NTPDase-3
MMRRC Submission 039130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R1028 (G1)
Quality Score164
Status Not validated
Chromosome9
Chromosomal Location120539818-120568327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120558361 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 208 (H208R)
Ref Sequence ENSEMBL: ENSMUSP00000036830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047687]
Predicted Effect probably benign
Transcript: ENSMUST00000047687
AA Change: H208R

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036830
Gene: ENSMUSG00000041608
AA Change: H208R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:GDA1_CD39 49 483 4.3e-102 PFAM
transmembrane domain 486 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143579
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.8%
  • 20x: 78.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma membrane-bound divalent cation-dependent E-type nucleotidase. The encoded protein is involved in the regulation of extracellular levels of ATP by hydrolysis of it and other nucleotides. Multiple transcript variants have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no deficits in nucleotide hydrolysis or alterations in nociceptive behaviors except for a modest reduction in beta-alanine-mediated itch behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 12: 105,710,189 probably benign Het
Ano8 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC 8: 71,480,971 probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bpifb9a G C 2: 154,262,407 E257Q possibly damaging Het
Cdh19 T C 1: 110,954,584 I59M probably benign Het
Cmah A G 13: 24,435,662 D171G probably damaging Het
Colec12 T C 18: 9,866,837 S683P unknown Het
Dixdc1 C T 9: 50,703,246 A168T probably benign Het
Dpp6 A G 5: 27,666,427 D461G probably benign Het
Fuz T C 7: 44,896,926 I39T probably damaging Het
Gprin3 T C 6: 59,354,609 N238D possibly damaging Het
Itpr3 G T 17: 27,091,369 A403S probably benign Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mtor G C 4: 148,538,830 G2046R possibly damaging Het
Myh13 T C 11: 67,356,181 S1243P possibly damaging Het
Net1 A T 13: 3,884,375 C441S probably damaging Het
Nlrp4e T C 7: 23,321,744 F552S probably damaging Het
Olfr1297 A T 2: 111,621,525 L183Q probably damaging Het
Olfr1387 G A 11: 49,460,220 M180I probably benign Het
Olfr1504 C A 19: 13,887,795 Q138H probably damaging Het
Ovch2 T C 7: 107,796,548 I88V probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pkhd1 A G 1: 20,117,726 Y3453H probably damaging Het
Rabgef1 T G 5: 130,212,862 L369* probably null Het
Rufy1 A T 11: 50,414,598 probably null Het
Sec16b T C 1: 157,560,917 V618A probably benign Het
Sh3rf1 A G 8: 61,393,787 R876G possibly damaging Het
Slc26a8 A G 17: 28,672,798 Y126H probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zp1 G A 19: 10,918,911 T150I probably benign Het
Other mutations in Entpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Entpd3 APN 9 120561941 missense probably damaging 1.00
R0054:Entpd3 UTSW 9 120557542 missense probably damaging 0.99
R0265:Entpd3 UTSW 9 120558481 missense probably damaging 1.00
R0417:Entpd3 UTSW 9 120557421 missense probably damaging 0.99
R0607:Entpd3 UTSW 9 120557405 missense possibly damaging 0.63
R1449:Entpd3 UTSW 9 120566489 missense probably damaging 1.00
R1490:Entpd3 UTSW 9 120554159 missense probably benign 0.03
R1846:Entpd3 UTSW 9 120558375 missense probably benign 0.33
R1848:Entpd3 UTSW 9 120558419 missense probably damaging 1.00
R2125:Entpd3 UTSW 9 120555654 missense probably damaging 1.00
R3810:Entpd3 UTSW 9 120562002 missense probably benign 0.00
R5101:Entpd3 UTSW 9 120566542 makesense probably null
R5109:Entpd3 UTSW 9 120566314 missense possibly damaging 0.95
R6822:Entpd3 UTSW 9 120562038 critical splice donor site probably null
R6968:Entpd3 UTSW 9 120560656 missense probably benign 0.01
R7107:Entpd3 UTSW 9 120560599 missense probably damaging 1.00
R7132:Entpd3 UTSW 9 120561020 missense probably benign 0.00
R7310:Entpd3 UTSW 9 120560755 critical splice donor site probably null
R7776:Entpd3 UTSW 9 120558502 missense probably damaging 1.00
R7831:Entpd3 UTSW 9 120543959 missense probably damaging 1.00
R7871:Entpd3 UTSW 9 120560586 missense possibly damaging 0.81
R7914:Entpd3 UTSW 9 120543959 missense probably damaging 1.00
R7954:Entpd3 UTSW 9 120560586 missense possibly damaging 0.81
X0017:Entpd3 UTSW 9 120555749 missense probably benign 0.41
X0024:Entpd3 UTSW 9 120561900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGGAGCTACTAGCAGAGCAC -3'
(R):5'- AAACCCCAGGATTGCATGGGTC -3'

Sequencing Primer
(F):5'- ATCTCACAGATCATCCTATAGTCCC -3'
(R):5'- GCAGACACTCAGGGCAGAC -3'
Posted On2014-01-05