Incidental Mutation 'R1028:Cmah'
ID95066
Institutional Source Beutler Lab
Gene Symbol Cmah
Ensembl Gene ENSMUSG00000016756
Gene Namecytidine monophospho-N-acetylneuraminic acid hydroxylase
SynonymsCMP-NeuAc hydroxylase
MMRRC Submission 039130-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1028 (G1)
Quality Score200
Status Not validated
Chromosome13
Chromosomal Location24327404-24477377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24435662 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 171 (D171G)
Ref Sequence ENSEMBL: ENSMUSP00000153248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050859] [ENSMUST00000110391] [ENSMUST00000167746] [ENSMUST00000224657] [ENSMUST00000224819] [ENSMUST00000224953]
Predicted Effect probably damaging
Transcript: ENSMUST00000050859
AA Change: D270G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061045
Gene: ENSMUSG00000016756
AA Change: D270G

DomainStartEndE-ValueType
Pfam:Rieske 14 107 6.2e-9 PFAM
Pfam:Lactamase_B_3 138 283 9.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110391
AA Change: D270G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106021
Gene: ENSMUSG00000016756
AA Change: D270G

DomainStartEndE-ValueType
Pfam:Rieske 15 107 1.5e-9 PFAM
Pfam:Lactamase_B_3 138 266 2.5e-12 PFAM
Pfam:Lactamase_B_2 154 351 1.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144621
Predicted Effect probably damaging
Transcript: ENSMUST00000167746
AA Change: D270G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129007
Gene: ENSMUSG00000016756
AA Change: D270G

DomainStartEndE-ValueType
Pfam:Rieske 14 107 6.2e-9 PFAM
Pfam:Lactamase_B_3 138 283 9.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224657
AA Change: D270G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224819
AA Change: D171G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224953
AA Change: D270G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225046
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.8%
  • 20x: 78.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with homozygous mutation of Cmah show subtle incidence of lethality, with slightly abnormal B and T cell physiolgy, including cytokine production in response to stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 12: 105,710,189 probably benign Het
Ano8 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC 8: 71,480,971 probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bpifb9a G C 2: 154,262,407 E257Q possibly damaging Het
Cdh19 T C 1: 110,954,584 I59M probably benign Het
Colec12 T C 18: 9,866,837 S683P unknown Het
Dixdc1 C T 9: 50,703,246 A168T probably benign Het
Dpp6 A G 5: 27,666,427 D461G probably benign Het
Entpd3 A G 9: 120,558,361 H208R probably benign Het
Fuz T C 7: 44,896,926 I39T probably damaging Het
Gprin3 T C 6: 59,354,609 N238D possibly damaging Het
Itpr3 G T 17: 27,091,369 A403S probably benign Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mtor G C 4: 148,538,830 G2046R possibly damaging Het
Myh13 T C 11: 67,356,181 S1243P possibly damaging Het
Net1 A T 13: 3,884,375 C441S probably damaging Het
Nlrp4e T C 7: 23,321,744 F552S probably damaging Het
Olfr1297 A T 2: 111,621,525 L183Q probably damaging Het
Olfr1387 G A 11: 49,460,220 M180I probably benign Het
Olfr1504 C A 19: 13,887,795 Q138H probably damaging Het
Ovch2 T C 7: 107,796,548 I88V probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pkhd1 A G 1: 20,117,726 Y3453H probably damaging Het
Rabgef1 T G 5: 130,212,862 L369* probably null Het
Rufy1 A T 11: 50,414,598 probably null Het
Sec16b T C 1: 157,560,917 V618A probably benign Het
Sh3rf1 A G 8: 61,393,787 R876G possibly damaging Het
Slc26a8 A G 17: 28,672,798 Y126H probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zp1 G A 19: 10,918,911 T150I probably benign Het
Other mutations in Cmah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cmah APN 13 24460276 nonsense probably null
IGL01074:Cmah APN 13 24464255 missense possibly damaging 0.59
IGL01339:Cmah APN 13 24430549 missense probably damaging 1.00
IGL01373:Cmah APN 13 24430549 missense probably damaging 1.00
R0095:Cmah UTSW 13 24436685 missense probably benign 0.01
R0462:Cmah UTSW 13 24436741 missense possibly damaging 0.58
R0718:Cmah UTSW 13 24417210 splice site probably null
R1474:Cmah UTSW 13 24439197 missense probably damaging 1.00
R1535:Cmah UTSW 13 24439220 missense probably damaging 0.99
R1773:Cmah UTSW 13 24417299 missense probably benign
R2116:Cmah UTSW 13 24428897 missense probably benign 0.01
R4208:Cmah UTSW 13 24417427 splice site probably null
R4868:Cmah UTSW 13 24464264 missense probably damaging 1.00
R5206:Cmah UTSW 13 24464284 missense probably damaging 1.00
R5792:Cmah UTSW 13 24456915 missense probably benign 0.14
R6246:Cmah UTSW 13 24466790 missense probably damaging 1.00
R6750:Cmah UTSW 13 24464252 missense probably damaging 1.00
R7157:Cmah UTSW 13 24436629 missense probably damaging 1.00
R7359:Cmah UTSW 13 24468556 missense probably benign 0.05
R7552:Cmah UTSW 13 24456955 missense possibly damaging 0.63
R7611:Cmah UTSW 13 24435647 missense probably benign 0.03
R8041:Cmah UTSW 13 24468618 missense probably benign 0.02
X0020:Cmah UTSW 13 24428876 missense probably damaging 1.00
Z1177:Cmah UTSW 13 24435684 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCCATGTTGTTGGTACACAAG -3'
(R):5'- GCACCATGTACTGTGCTCTCTGAAG -3'

Sequencing Primer
(F):5'- GGACATAACTGTCTTTGCTCAAAGC -3'
(R):5'- CTCTCTGAAGTGGGGACAGATG -3'
Posted On2014-01-05