Incidental Mutation 'R1136:Prss21'
ID95078
Institutional Source Beutler Lab
Gene Symbol Prss21
Ensembl Gene ENSMUSG00000024116
Gene Nameprotease, serine 21
SynonymsmT4, testisin, TESP5, 1700023E12Rik
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1136 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23868056-23873114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23872994 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 312 (L312H)
Ref Sequence ENSEMBL: ENSMUSP00000024928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024928]
Predicted Effect probably damaging
Transcript: ENSMUST00000024928
AA Change: L312H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024928
Gene: ENSMUSG00000024116
AA Change: L312H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 54 291 1.18e-94 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell-surface anchored serine protease, which is a member of the trypsin family of serine proteases. The encoded protein is predicted to be active on peptide linkages involving the carboxyl group of lysine or arginine. The encoded protein localizes to the cytoplasm and the plasma membrane of premeiotic testicular germ cells and may be involved in progression of testicular tumors of germ cell origin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for one knock-out allele impaires fertilization of epididymal sperm only in an in vitro experiment. Mice homozygous for another knock-out allele exhibit defective sperm maturation during passage through the epididymis and decreased spermfertilization capability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Prss21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Prss21 APN 17 23872440 missense possibly damaging 0.48
IGL03151:Prss21 APN 17 23869402 missense probably damaging 0.98
R2299:Prss21 UTSW 17 23869589 missense probably benign 0.18
R3615:Prss21 UTSW 17 23872831 missense probably benign 0.20
R3616:Prss21 UTSW 17 23872831 missense probably benign 0.20
R4589:Prss21 UTSW 17 23872822 missense possibly damaging 0.96
R5691:Prss21 UTSW 17 23868785 splice site probably null
R6946:Prss21 UTSW 17 23868164 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTATCCTCACCCAGTCTGTCAGC -3'
(R):5'- CAACAGGAGGCCATCAGAGTTCAAG -3'

Sequencing Primer
(F):5'- AGTCTGTCAGCCCCATAGC -3'
(R):5'- GCCATCAGAGTTCAAGGAAAG -3'
Posted On2014-01-05