Incidental Mutation 'R1136:Nudt3'
ID95085
Institutional Source Beutler Lab
Gene Symbol Nudt3
Ensembl Gene ENSMUSG00000024213
Gene Namenudix (nucleotide diphosphate linked moiety X)-type motif 3
SynonymsDipp, diphosphoinositol polyphosphate phosphohydrolase, 1110011B09Rik
MMRRC Submission 039209-MU
Accession Numbers

NCBI RefSeq: NM_019837.2; MGI:1928484

Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R1136 (G1)
Quality Score82
Status Validated
Chromosome17
Chromosomal Location27579382-27623495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27623106 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 27 (R27L)
Ref Sequence ENSEMBL: ENSMUSP00000025050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025050] [ENSMUST00000062397] [ENSMUST00000114886] [ENSMUST00000146321] [ENSMUST00000156429] [ENSMUST00000176458] [ENSMUST00000176876]
Predicted Effect probably benign
Transcript: ENSMUST00000025050
AA Change: R27L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025050
Gene: ENSMUSG00000024213
AA Change: R27L

DomainStartEndE-ValueType
Pfam:NUDIX 17 142 3.9e-20 PFAM
low complexity region 153 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062397
AA Change: R27L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000059061
Gene: ENSMUSG00000024213
AA Change: R27L

DomainStartEndE-ValueType
Pfam:NUDIX 17 135 1.5e-18 PFAM
low complexity region 144 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114886
SMART Domains Protein: ENSMUSP00000110536
Gene: ENSMUSG00000024213

DomainStartEndE-ValueType
Pfam:NUDIX 1 116 1.3e-18 PFAM
low complexity region 124 136 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146321
AA Change: R27L
Predicted Effect probably benign
Transcript: ENSMUST00000156429
Predicted Effect probably benign
Transcript: ENSMUST00000176458
SMART Domains Protein: ENSMUSP00000135175
Gene: ENSMUSG00000024213

DomainStartEndE-ValueType
Pfam:NUDIX 1 58 3.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176876
AA Change: R27L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135890
Gene: ENSMUSG00000024213
AA Change: R27L

DomainStartEndE-ValueType
Pfam:NUDIX 17 117 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231767
Meta Mutation Damage Score 0.4697 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUDT3 belongs to the MutT, or Nudix, protein family. Nudix proteins act as homeostatic checkpoints at important stages in nucleoside phosphate metabolic pathways, guarding against elevated levels of potentially dangerous intermediates, like 8-oxo-dGTP, which promotes AT-to-CG transversions (Safrany et al., 1998 [PubMed 9822604]).[supplied by OMIM, Feb 2011]
Allele List at MGI

All alleles(57) : Targeted(2) Gene trapped(55)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Nudt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Nudt3 UTSW 17 27596715 splice site probably benign
R3781:Nudt3 UTSW 17 27580808 missense possibly damaging 0.83
R3782:Nudt3 UTSW 17 27580808 missense possibly damaging 0.83
R5625:Nudt3 UTSW 17 27583228 missense probably damaging 1.00
R7664:Nudt3 UTSW 17 27623175 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTCCAACCATACGGACTCAGCAG -3'
(R):5'- TGTAGCGGACACACAGACCCTCCTC -3'

Sequencing Primer
(F):5'- gggagggagggagggag -3'
(R):5'- CTCCTCCCCGCCCTCTC -3'
Posted On2014-01-05