Incidental Mutation 'R1136:Akap8l'
ID95089
Institutional Source Beutler Lab
Gene Symbol Akap8l
Ensembl Gene ENSMUSG00000002625
Gene NameA kinase (PRKA) anchor protein 8-like
SynonymsNakap95
MMRRC Submission 039209-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R1136 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32321425-32350581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32332483 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 511 (R511H)
Ref Sequence ENSEMBL: ENSMUSP00000051389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050214]
Predicted Effect probably damaging
Transcript: ENSMUST00000050214
AA Change: R511H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051389
Gene: ENSMUSG00000002625
AA Change: R511H

DomainStartEndE-ValueType
low complexity region 37 62 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 307 324 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
coiled coil region 356 383 N/A INTRINSIC
ZnF_C2H2 389 413 1.05e1 SMART
SCOP:d1jvr__ 538 613 7e-5 SMART
low complexity region 628 640 N/A INTRINSIC
Meta Mutation Damage Score 0.5342 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy2 C T 13: 68,730,317 G401S probably damaging Het
Bmp2 T C 2: 133,560,927 F133L probably damaging Het
C1qtnf3 A G 15: 10,978,584 E290G probably damaging Het
Ccdc180 C A 4: 45,914,589 D701E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Csmd3 A T 15: 47,675,817 I1508N probably damaging Het
Dgkh T C 14: 78,624,889 R80G probably damaging Het
Dock1 T A 7: 134,848,173 V805D possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Ercc6l2 T A 13: 63,869,120 V679D possibly damaging Het
Esp6 T C 17: 40,565,393 Y111H probably benign Het
Focad T C 4: 88,326,180 F799S unknown Het
Foxred1 C A 9: 35,205,037 M438I probably benign Het
Galnt11 T G 5: 25,258,945 V405G probably damaging Het
Gm4847 A G 1: 166,630,366 Y473H probably damaging Het
Gpbp1l1 C T 4: 116,592,918 T461M probably damaging Het
Hnrnpu A T 1: 178,331,225 probably benign Het
Kmt2d A T 15: 98,857,765 probably benign Het
Matr3 A G 18: 35,572,895 H291R probably damaging Het
Mfsd14b C T 13: 65,095,692 S46N probably benign Het
Mtch1 C T 17: 29,333,770 probably null Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mylk T C 16: 35,000,318 I1880T probably damaging Het
N4bp2 T C 5: 65,808,472 L1288P probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Nmd3 T A 3: 69,746,716 probably benign Het
Npdc1 G T 2: 25,407,715 A127S probably benign Het
Nudt3 C A 17: 27,623,106 R27L probably benign Het
Nwd1 C T 8: 72,697,769 probably benign Het
Papd4 C T 13: 93,175,697 probably null Het
Pex7 T A 10: 19,888,688 I170F probably benign Het
Phyhipl A G 10: 70,569,072 V57A probably damaging Het
Pkhd1 G A 1: 20,522,829 P1687S possibly damaging Het
Plekhj1 A T 10: 80,797,820 probably null Het
Prss21 T A 17: 23,872,994 L312H probably damaging Het
Samsn1 T C 16: 75,873,520 I232V probably null Het
Sec63 A T 10: 42,806,546 D411V probably damaging Het
Slc44a4 C T 17: 34,928,022 H343Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmtc3 A G 10: 100,472,043 probably benign Het
Trafd1 C T 5: 121,373,324 R477H possibly damaging Het
Uhrf2 T A 19: 30,056,226 probably benign Het
Vmn2r68 T A 7: 85,222,341 D578V possibly damaging Het
Wdcp G A 12: 4,851,655 V504I possibly damaging Het
Wdr93 T C 7: 79,773,448 Y487H probably damaging Het
Zfp457 T C 13: 67,293,782 H147R probably damaging Het
Other mutations in Akap8l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Akap8l APN 17 32333097 missense possibly damaging 0.82
IGL01603:Akap8l APN 17 32345353 missense probably damaging 1.00
IGL02028:Akap8l APN 17 32338521 splice site probably null
IGL02033:Akap8l APN 17 32338272 missense probably damaging 1.00
IGL02301:Akap8l APN 17 32332926 splice site probably benign
R1137:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1192:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1277:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1279:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1703:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1705:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1706:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1727:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1763:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1774:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1796:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R1954:Akap8l UTSW 17 32336736 missense possibly damaging 0.74
R2072:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2073:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2074:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2107:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2108:Akap8l UTSW 17 32332483 missense probably damaging 1.00
R2214:Akap8l UTSW 17 32338825 critical splice acceptor site probably null
R2215:Akap8l UTSW 17 32321595 missense possibly damaging 0.72
R2219:Akap8l UTSW 17 32334631 missense probably benign 0.23
R2234:Akap8l UTSW 17 32338803 missense probably damaging 1.00
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R2871:Akap8l UTSW 17 32338442 missense possibly damaging 0.84
R4273:Akap8l UTSW 17 32321931 nonsense probably null
R4379:Akap8l UTSW 17 32321514 unclassified probably benign
R5061:Akap8l UTSW 17 32332894 missense probably damaging 1.00
R5337:Akap8l UTSW 17 32336394 missense possibly damaging 0.71
R5377:Akap8l UTSW 17 32321511 unclassified probably benign
R5579:Akap8l UTSW 17 32321942 missense probably damaging 1.00
R5609:Akap8l UTSW 17 32338400 missense probably damaging 1.00
R5667:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5671:Akap8l UTSW 17 32338292 missense probably damaging 1.00
R5747:Akap8l UTSW 17 32345378 missense probably damaging 0.97
R6186:Akap8l UTSW 17 32333044 missense probably benign 0.02
R6400:Akap8l UTSW 17 32336320 missense probably damaging 0.99
R6482:Akap8l UTSW 17 32345396 missense possibly damaging 0.94
R6712:Akap8l UTSW 17 32332888 missense probably damaging 1.00
R7165:Akap8l UTSW 17 32338412 missense probably damaging 0.99
R7485:Akap8l UTSW 17 32335571 missense probably benign 0.03
R7729:Akap8l UTSW 17 32333094 missense probably damaging 1.00
V5088:Akap8l UTSW 17 32336739 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATCCTTGTACACCAGGCAAC -3'
(R):5'- TTTGGCACCTGAGACTGTGATGAC -3'

Sequencing Primer
(F):5'- agccttgaacttacagagacc -3'
(R):5'- AGACTGTGATGACTGCTTTCTTC -3'
Posted On2014-01-05