Incidental Mutation 'R1137:Muc1'
ID95124
Institutional Source Beutler Lab
Gene Symbol Muc1
Ensembl Gene ENSMUSG00000042784
Gene Namemucin 1, transmembrane
SynonymsEMA, CD227, Muc-1
MMRRC Submission 039210-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R1137 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89229057-89233381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89230438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 196 (T196S)
Ref Sequence ENSEMBL: ENSMUSP00000041963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000041022] [ENSMUST00000041142] [ENSMUST00000090924] [ENSMUST00000107464] [ENSMUST00000119084] [ENSMUST00000143637] [ENSMUST00000174126]
Predicted Effect probably benign
Transcript: ENSMUST00000029682
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041022
SMART Domains Protein: ENSMUSP00000036053
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 271 395 3e-13 BLAST
FN3 430 515 2.03e-2 SMART
low complexity region 561 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041142
AA Change: T196S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041963
Gene: ENSMUSG00000042784
AA Change: T196S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
internal_repeat_2 48 106 4.93e-6 PROSPERO
internal_repeat_1 79 151 3.46e-38 PROSPERO
low complexity region 153 181 N/A INTRINSIC
internal_repeat_1 183 254 3.46e-38 PROSPERO
internal_repeat_2 192 259 4.93e-6 PROSPERO
low complexity region 277 292 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
low complexity region 382 400 N/A INTRINSIC
SEA 412 528 6.2e-43 SMART
low complexity region 537 552 N/A INTRINSIC
Blast:SEA 557 624 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000090924
SMART Domains Protein: ENSMUSP00000088442
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 20 120 1.92e-6 SMART
BBOX 209 250 9.59e-7 SMART
Blast:BBC 258 382 8e-13 BLAST
FN3 417 502 2.03e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102300
Predicted Effect probably benign
Transcript: ENSMUST00000107464
SMART Domains Protein: ENSMUSP00000103088
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 10 110 1.92e-6 SMART
BBOX 199 240 9.59e-7 SMART
Blast:BBC 248 372 2e-13 BLAST
FN3 407 492 2.03e-2 SMART
low complexity region 538 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119084
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126372
Predicted Effect probably benign
Transcript: ENSMUST00000136881
SMART Domains Protein: ENSMUSP00000120337
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
Pfam:TSP_3 1 31 5.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139419
Predicted Effect probably benign
Transcript: ENSMUST00000143637
SMART Domains Protein: ENSMUSP00000119270
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 270 391 4e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153129
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174324
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display delayed mammary tumor progression, impaired intestinal absorption of cholesterol, decreased gastric mucus accumulation, reduced secretion and accumulation of gallbladder mucin, and decreased susceptibility to cholesterol gallstone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,832 S54T probably benign Het
Ahdc1 A G 4: 133,062,113 T222A possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Cep250 A G 2: 155,990,840 K1561E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Clca4a A G 3: 144,970,685 V78A probably damaging Het
Clec4n G A 6: 123,246,567 M170I possibly damaging Het
Cp G T 3: 19,978,952 A648S probably benign Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dnah8 A G 17: 30,855,936 D4543G probably damaging Het
Elp3 A G 14: 65,547,921 V477A probably damaging Het
Exoc6b A G 6: 84,908,223 S245P probably benign Het
Fkbp9 G T 6: 56,860,697 G312V probably damaging Het
Htr4 A G 18: 62,437,553 I226M probably damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Kif20b T C 19: 34,937,086 probably null Het
Kmt2c C A 5: 25,310,983 V2621F possibly damaging Het
Lif A G 11: 4,269,237 D172G probably damaging Het
Llgl1 C A 11: 60,704,733 H82N probably benign Het
Lrwd1 T C 5: 136,133,419 I162M probably benign Het
Mdn1 T A 4: 32,694,511 I1078N probably damaging Het
Myh7b T C 2: 155,622,714 L657P probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Ppp1cb T C 5: 32,487,671 M55T probably damaging Het
Ppp1r9a T C 6: 5,159,697 M1078T possibly damaging Het
Rarg T C 15: 102,241,160 T125A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc5a7 G A 17: 54,293,011 R125C probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tigit G T 16: 43,649,122 T202N probably benign Het
Tmem132b C T 5: 125,783,542 A617V possibly damaging Het
Tpm1 T C 9: 67,031,118 probably null Het
Ubr3 A G 2: 69,938,315 probably benign Het
Vcan T A 13: 89,704,303 D846V probably damaging Het
Vmn1r16 T G 6: 57,323,236 N134H probably damaging Het
Other mutations in Muc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Muc1 APN 3 89230754 missense probably benign 0.01
IGL01549:Muc1 APN 3 89231810 missense probably damaging 1.00
IGL01969:Muc1 APN 3 89232006 missense probably damaging 1.00
IGL02233:Muc1 APN 3 89231628 missense probably benign 0.11
IGL03160:Muc1 APN 3 89233024 missense possibly damaging 0.89
R0670:Muc1 UTSW 3 89230532 missense probably benign 0.00
R0682:Muc1 UTSW 3 89231132 missense probably damaging 1.00
R0702:Muc1 UTSW 3 89230220 missense probably benign 0.00
R0744:Muc1 UTSW 3 89230328 missense possibly damaging 0.92
R1270:Muc1 UTSW 3 89232107 missense probably damaging 1.00
R1673:Muc1 UTSW 3 89231772 missense possibly damaging 0.76
R1869:Muc1 UTSW 3 89231810 missense probably damaging 1.00
R2169:Muc1 UTSW 3 89231596 missense probably damaging 1.00
R4460:Muc1 UTSW 3 89231563 missense probably damaging 0.98
R4461:Muc1 UTSW 3 89231563 missense probably damaging 0.98
R4672:Muc1 UTSW 3 89232077 missense probably damaging 0.99
R5892:Muc1 UTSW 3 89230993 missense probably benign 0.04
R6039:Muc1 UTSW 3 89232029 missense probably damaging 1.00
R6039:Muc1 UTSW 3 89232029 missense probably damaging 1.00
R6931:Muc1 UTSW 3 89229159 unclassified probably benign
R7400:Muc1 UTSW 3 89230646 missense possibly damaging 0.63
X0065:Muc1 UTSW 3 89230286 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGTCCACAGTGGCACCTCTTC -3'
(R):5'- CTGGAATGATAGCTGAGCCTGACG -3'

Sequencing Primer
(F):5'- AGTGGCACCTCTTCAGCTC -3'
(R):5'- CATGCTACTGTAAACTGGAGTG -3'
Posted On2014-01-05