Incidental Mutation 'R1137:Clca4a'
ID 95128
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Name chloride channel accessory 4A
Synonyms Clca6, 9130020L07Rik
MMRRC Submission 039210-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R1137 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144952480-144975045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144970685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 78 (V78A)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029923
AA Change: V78A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: V78A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198898
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,832 S54T probably benign Het
Ahdc1 A G 4: 133,062,113 T222A possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Cep250 A G 2: 155,990,840 K1561E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Clec4n G A 6: 123,246,567 M170I possibly damaging Het
Cp G T 3: 19,978,952 A648S probably benign Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dnah8 A G 17: 30,855,936 D4543G probably damaging Het
Elp3 A G 14: 65,547,921 V477A probably damaging Het
Exoc6b A G 6: 84,908,223 S245P probably benign Het
Fkbp9 G T 6: 56,860,697 G312V probably damaging Het
Htr4 A G 18: 62,437,553 I226M probably damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Kif20b T C 19: 34,937,086 probably null Het
Kmt2c C A 5: 25,310,983 V2621F possibly damaging Het
Lif A G 11: 4,269,237 D172G probably damaging Het
Llgl1 C A 11: 60,704,733 H82N probably benign Het
Lrwd1 T C 5: 136,133,419 I162M probably benign Het
Mdn1 T A 4: 32,694,511 I1078N probably damaging Het
Muc1 A T 3: 89,230,438 T196S probably benign Het
Myh7b T C 2: 155,622,714 L657P probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Ppp1cb T C 5: 32,487,671 M55T probably damaging Het
Ppp1r9a T C 6: 5,159,697 M1078T possibly damaging Het
Rarg T C 15: 102,241,160 T125A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc5a7 G A 17: 54,293,011 R125C probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tigit G T 16: 43,649,122 T202N probably benign Het
Tmem132b C T 5: 125,783,542 A617V possibly damaging Het
Tpm1 T C 9: 67,031,118 probably null Het
Ubr3 A G 2: 69,938,315 probably benign Het
Vcan T A 13: 89,704,303 D846V probably damaging Het
Vmn1r16 T G 6: 57,323,236 N134H probably damaging Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144954939 missense probably damaging 0.99
IGL01139:Clca4a APN 3 144966269 missense probably damaging 0.99
IGL01371:Clca4a APN 3 144960672 missense probably damaging 1.00
IGL01609:Clca4a APN 3 144953780 missense probably damaging 1.00
IGL01998:Clca4a APN 3 144958126 missense probably damaging 0.98
IGL02172:Clca4a APN 3 144970394 nonsense probably null
IGL02217:Clca4a APN 3 144961996 missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144955071 missense probably damaging 1.00
IGL02975:Clca4a APN 3 144963769 missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144957318 missense probably benign 0.07
IGL03049:Clca4a APN 3 144970755 splice site probably benign
IGL03058:Clca4a APN 3 144961834 splice site probably benign
IGL03259:Clca4a APN 3 144958080 missense probably damaging 1.00
IGL03263:Clca4a APN 3 144966431 missense probably damaging 1.00
IGL03334:Clca4a APN 3 144953866 missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144968311 missense probably damaging 1.00
R0201:Clca4a UTSW 3 144960717 missense probably benign 0.00
R0316:Clca4a UTSW 3 144953764 missense probably damaging 1.00
R0524:Clca4a UTSW 3 144969393 missense probably damaging 1.00
R0680:Clca4a UTSW 3 144969367 missense probably damaging 1.00
R0688:Clca4a UTSW 3 144961974 missense probably damaging 1.00
R1568:Clca4a UTSW 3 144952929 missense probably benign 0.00
R1719:Clca4a UTSW 3 144963755 missense probably damaging 1.00
R2055:Clca4a UTSW 3 144970728 missense probably damaging 1.00
R3078:Clca4a UTSW 3 144968253 missense probably damaging 0.99
R3080:Clca4a UTSW 3 144963790 missense probably damaging 1.00
R3789:Clca4a UTSW 3 144974956 missense probably damaging 1.00
R3881:Clca4a UTSW 3 144957318 missense probably benign 0.07
R4133:Clca4a UTSW 3 144969352 missense probably benign 0.07
R4402:Clca4a UTSW 3 144952848 missense probably benign 0.08
R4455:Clca4a UTSW 3 144957259 missense probably damaging 1.00
R4577:Clca4a UTSW 3 144954969 missense probably damaging 0.97
R4683:Clca4a UTSW 3 144954940 missense probably damaging 1.00
R5135:Clca4a UTSW 3 144954946 missense probably damaging 1.00
R5267:Clca4a UTSW 3 144953812 missense probably damaging 1.00
R5345:Clca4a UTSW 3 144970461 missense probably damaging 1.00
R6311:Clca4a UTSW 3 144966413 missense probably damaging 0.99
R6492:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6493:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6494:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6861:Clca4a UTSW 3 144970655 missense probably benign
R7102:Clca4a UTSW 3 144961909 missense probably benign 0.01
R7133:Clca4a UTSW 3 144961890 nonsense probably null
R7171:Clca4a UTSW 3 144958173 missense probably benign
R7516:Clca4a UTSW 3 144966248 missense probably damaging 1.00
R7642:Clca4a UTSW 3 144953751 missense probably benign 0.11
R7731:Clca4a UTSW 3 144952785 missense probably benign 0.02
R7787:Clca4a UTSW 3 144953833 missense probably benign
R7820:Clca4a UTSW 3 144960671 missense probably damaging 1.00
R7895:Clca4a UTSW 3 144968405 missense probably benign 0.19
R7991:Clca4a UTSW 3 144952739 missense possibly damaging 0.75
R8240:Clca4a UTSW 3 144970727 missense probably damaging 1.00
R9308:Clca4a UTSW 3 144970422 missense probably damaging 1.00
R9373:Clca4a UTSW 3 144966372 missense possibly damaging 0.66
R9488:Clca4a UTSW 3 144953771 missense probably damaging 1.00
R9772:Clca4a UTSW 3 144970661 missense probably damaging 1.00
R9781:Clca4a UTSW 3 144961952 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTGCCACTTTAATGTCAGCCTGAG -3'
(R):5'- TGCTGAGGAATGAGCCTGATGC -3'

Sequencing Primer
(F):5'- TGTCAGCCTGAGAATGTTTAAAAAG -3'
(R):5'- CATGGCTCCTTTTGTAGTAACAG -3'
Posted On 2014-01-05