Incidental Mutation 'R1137:Creld2'
ID95222
Institutional Source Beutler Lab
Gene Symbol Creld2
Ensembl Gene ENSMUSG00000023272
Gene Namecysteine-rich with EGF-like domains 2
Synonyms
MMRRC Submission 039210-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1137 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location88819646-88826683 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 88820631 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 103 (W103*)
Ref Sequence ENSEMBL: ENSMUSP00000024042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024042] [ENSMUST00000043087] [ENSMUST00000159328] [ENSMUST00000162183]
Predicted Effect probably null
Transcript: ENSMUST00000024042
AA Change: W103*
SMART Domains Protein: ENSMUSP00000024042
Gene: ENSMUSG00000023272
AA Change: W103*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF3456 28 86 1.3e-7 PFAM
low complexity region 90 100 N/A INTRINSIC
EGF 137 176 3.76e-1 SMART
FU 191 238 1.2e-7 SMART
EGF_like 228 273 1.76e-3 SMART
FU 251 298 5.08e-6 SMART
EGF_CA 288 329 3.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043087
SMART Domains Protein: ENSMUSP00000043480
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 267 4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159328
SMART Domains Protein: ENSMUSP00000125534
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 169 6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160222
Predicted Effect probably benign
Transcript: ENSMUST00000162183
SMART Domains Protein: ENSMUSP00000123935
Gene: ENSMUSG00000035845

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 15 406 3.3e-44 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,250,832 S54T probably benign Het
Ahdc1 A G 4: 133,062,113 T222A possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Cep250 A G 2: 155,990,840 K1561E probably benign Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Clca4a A G 3: 144,970,685 V78A probably damaging Het
Clec4n G A 6: 123,246,567 M170I possibly damaging Het
Cp G T 3: 19,978,952 A648S probably benign Het
Dnah8 A G 17: 30,855,936 D4543G probably damaging Het
Elp3 A G 14: 65,547,921 V477A probably damaging Het
Exoc6b A G 6: 84,908,223 S245P probably benign Het
Fkbp9 G T 6: 56,860,697 G312V probably damaging Het
Htr4 A G 18: 62,437,553 I226M probably damaging Het
Impa2 G A 18: 67,318,427 V264I probably benign Het
Kif20b T C 19: 34,937,086 probably null Het
Kmt2c C A 5: 25,310,983 V2621F possibly damaging Het
Lif A G 11: 4,269,237 D172G probably damaging Het
Llgl1 C A 11: 60,704,733 H82N probably benign Het
Lrwd1 T C 5: 136,133,419 I162M probably benign Het
Mdn1 T A 4: 32,694,511 I1078N probably damaging Het
Muc1 A T 3: 89,230,438 T196S probably benign Het
Myh7b T C 2: 155,622,714 L657P probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Ppp1cb T C 5: 32,487,671 M55T probably damaging Het
Ppp1r9a T C 6: 5,159,697 M1078T possibly damaging Het
Rarg T C 15: 102,241,160 T125A probably damaging Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Slc5a7 G A 17: 54,293,011 R125C probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tigit G T 16: 43,649,122 T202N probably benign Het
Tmem132b C T 5: 125,783,542 A617V possibly damaging Het
Tpm1 T C 9: 67,031,118 probably null Het
Ubr3 A G 2: 69,938,315 probably benign Het
Vcan T A 13: 89,704,303 D846V probably damaging Het
Vmn1r16 T G 6: 57,323,236 N134H probably damaging Het
Other mutations in Creld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0510:Creld2 UTSW 15 88819956 missense probably damaging 1.00
R1163:Creld2 UTSW 15 88820631 nonsense probably null
R1164:Creld2 UTSW 15 88820631 nonsense probably null
R1206:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1207:Creld2 UTSW 15 88820631 nonsense probably null
R1457:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R1475:Creld2 UTSW 15 88820631 nonsense probably null
R1915:Creld2 UTSW 15 88820631 nonsense probably null
R2105:Creld2 UTSW 15 88820631 nonsense probably null
R4297:Creld2 UTSW 15 88823753 missense probably damaging 1.00
R5843:Creld2 UTSW 15 88826429 missense probably damaging 1.00
R6066:Creld2 UTSW 15 88823766 missense possibly damaging 0.95
R6402:Creld2 UTSW 15 88823141 missense probably damaging 0.99
R6454:Creld2 UTSW 15 88823071 nonsense probably null
R6543:Creld2 UTSW 15 88825278 missense probably benign 0.00
R6808:Creld2 UTSW 15 88825210 missense probably damaging 1.00
R6912:Creld2 UTSW 15 88819997 missense probably damaging 1.00
R7342:Creld2 UTSW 15 88826407 missense probably benign 0.03
R8058:Creld2 UTSW 15 88826429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGAAACTCAGACTGGAGCCCC -3'
(R):5'- CTGAAGCAACTAAGGACCTCAGGTG -3'

Sequencing Primer
(F):5'- GGCTTCCCTGACTAATGGAATAAG -3'
(R):5'- CTAAGGACCTCAGGTGATTCG -3'
Posted On2014-01-05